Expression of Murine IL-12 Is Regulated by
Translational Control of the p35 Subunit
This information is current as
of June 15, 2017.
Subscription
Permissions
Email Alerts
J Immunol 1999; 162:4069-4078; ;
http://www.jimmunol.org/content/162/7/4069
This article cites 44 articles, 33 of which you can access for free at:
http://www.jimmunol.org/content/162/7/4069.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 1999 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
References
Jennifer M. Babik, Elizabeth Adams, Yukiko Tone, Paul J.
Fairchild, Masahide Tone and Herman Waldmann
Expression of Murine IL-12 Is Regulated by Translational
Control of the p35 Subunit1
Jennifer M. Babik, Elizabeth Adams, Yukiko Tone, Paul J. Fairchild, Masahide Tone,2 and
Herman Waldmann
I
nterleukin-12 plays a central role in the immune response as
a cytokine whose functions bridge innate resistance and Agspecific adaptive immunity (1). It is produced by phagocytic
cells and APCs, in particular macrophages (2) and dendritic cells
(3, 4). IL-12 is secreted as the result of a non-Ag-specific interaction with bacteria, bacterial products such as LPS, and intracellular
parasites (2, 5, 6). It is also produced by APCs after ligation of
CD40 with CD40 ligand during an Ag-specific interaction with
activated T cells (7). IL-12 stimulates IFN-g production by NK
and T cells and induces the development and differentiation of Th1
cells (1). However, overproduction of IL-12 can be dangerous to
the host, e.g., in the immunopathology of organ-specific autoimmune diseases (8), suggesting that the level of this cytokine must
be tightly controlled.
IL-12 has features unique among cytokines. It is a 70-kDa heterodimer of two subunits, p40 (40 kDa) and p35 (35 kDa), encoded
by separate genes, which are disulfide-bonded in the bioactive
form of the protein (9, 10). Although both subunits must be coexpressed in the same cell to generate the bioactive form (10),
production of the subunits is regulated independently (11–14). Initially, it was reported that p35 transcripts were ubiquitously and
constitutively expressed in various cell types, while p40 transcripts
were highly regulated (1, 2). It was therefore believed that IL-12
expression was controlled at the level of p40 production. In fact, it
has often been assumed that p40 mRNA or protein production
alone is indicative of IL-12 heterodimer formation. However, reSir William Dunn School of Pathology, University of Oxford, Oxford, United
Kingdom
Received for publication September 21, 1998. Accepted for publication January
6, 1999.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by the Medical Research Council, U.K.; The Gilman
Foundation; and a Rhodes Scholarship (to J.B.).
2
Address correspondence and reprint requests to Dr. Masahide Tone, Sir William
Dunn School of Pathology, South Parks Rd., Oxford, United Kingdom OX1 3RE.
E-mail address: mtone@molbiol.ox.ac.uk
Copyright © 1999 by The American Association of Immunologists
cent evidence has shown that p35 transcripts are highly regulated
in some cases (12–17), and that expression of the p35 subunit can
even determine the level of IL-12 heterodimer production (12, 13).
There have been many recent reports dealing with the molecular
mechanisms of p40 gene expression, where control seems to be
mainly at the level of transcription. Multiple regulatory elements
have been implicated in p40 regulation, in particular NF-kB (18),
Ets-2 (19, 20), and members of the IFN regulatory factor (IRF)
(21, 22), and CCAAT enhancer binding protein (C/EBP) (23) families of transcription factors. On the other hand, p35 gene regulation has remained poorly defined. Our group and others have
cloned and sequenced the murine p35 subunit gene and its
cDNA (24 –26). We have determined that p35 has multiple transcription start sites and can initiate from either of two 59 exons,
resulting in mRNA isoforms with different 59 untranslated
regions (UTRs)3 (25).
In this paper we determined the mechanism of p35 gene regulation in two different cell types, the murine B cell lymphoma line
A20 and bone marrow-derived dendritic cells (bmDC). In both cell
types, we found that p35 mRNA was up-regulated by LPS stimulation, and that expression of the p35 subunit was further regulated at the level of translation. In nonstimulated cells, p35 transcripts contained an additional upstream ATG, whose presence in
the 59 UTR was shown to inhibit translation of the p35 subunit
from downstream. After LPS stimulation, however, transcription
initiated from alternate positions, resulting in transcripts with a
different 59 UTR that did not contain this upstream ATG. These
transcripts were then able to support translation of the p35 subunit,
which could subsequently dimerize with p40 to produce bioactive
IL-12. The results presented here confirm that p35 is highly regulated and, unlike the p40 subunit, is controlled translationally as
well as transcriptionally.
3
Abbreviations used in this paper: UTR, untranslated region; bmDC, bone marrowderived dendritic cells; RACE, rapid amplification of complementary deoxyribonucleic acid ends; EF-1a, elongation factor-1a; ORF, open reading frame; aa, amino
acids; HPRT, hypoxanthine phosphoribosyltransferase.
0022-1767/99/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
IL-12 is a heterodimer of two subunits, p35 and p40, encoded by separate genes that are regulated independently. To investigate
the mechanisms underlying the regulation of the p35 gene, we characterized murine p35 expression in the B cell lymphoma line
A20 and in bone marrow-derived dendritic cells. Multiple transcription start sites were identified in both cell types, resulting in
four p35 mRNA isoforms (types I–IV) that differ in the number and position of upstream ATGs in their 5* untranslated regions.
In nonstimulated cells, the predominant forms of p35 message (types II and IV) contained an additional upstream ATG, whose
presence was shown to inhibit the downstream translation of the p35 subunit. After LPS stimulation, however, transcription
initiated from alternate positions, so that the proportion of transcripts not containing this upstream ATG (types I and III) was
significantly increased in the population of p35 mRNA. These type I and type III transcripts readily supported translation of the
p35 subunit and its incorporation into bioactive IL-12. Furthermore, p35 mRNA levels were substantially up-regulated after LPS
stimulation in both cell types. Thus, our results show that p35 gene expression is highly regulated by both transcriptional and
translational mechanisms. The Journal of Immunology, 1999, 162: 4069 – 4078.
4070
REGULATION OF IL-12 EXPRESSION BY TRANSLATIONAL CONTROL OF p35
A20 and RAW 264 cells were cultured in Iscove’s modified Dulbecco’s
medium supplemented with 5% FCS, 50 U/ml penicillin, and 50 mg/ml
streptomycin. The bmDC were prepared from CBA/Ca mice based on the
method of Inaba et al. (27) with minor modifications. Isolated bmDC were
90 –95% pure, as determined by expression of the dendritic cell marker
CD11c. When required, A20, RAW 264, and bmDC were stimulated with
LPS (20 mg/ml) for 42 h (luciferase assay), 24 h (primer extension assay,
Northern blot hybridization, IL-12 bioassay), or 18 h (RACE, RT-PCR).
responding to 1283 in Fig. 2A), 35.III (59 end corresponding to 2459 in
Fig. 2A), and 35.IIIa (59 end the same as in 35.III and the ATG sequence
at 1362 to 1364 in Fig. 2A mutated to a GCG by PCR). Fragments 35.I
and 35.II were amplified on an intron 1-containing cDNA template, while
fragments 35.III and 35.IIIa were amplified on an exon 1-containing cDNA
template. These p35 cDNA fragments were then introduced downstream of
the elongation factor-1a (EF-1a) promoter in the mammalian expression
vector pOXCD59neo vector (containing a neomycin resistance gene).
The resulting expression plasmids were transfected into RAW 264 cells
by electroporation, and stable transfectants were selected using
G418 (1 mg/ml).
Primer extension assay
Northern blot hybridization
Primer extension was performed on poly(A)1 RNA (20 mg) from A20 cells
using the following 32P-labeled antisense primers: primer 1, GGC
CAAACTGAGGTGGTTTAGGAGGGCAAGG, corresponding to a sequence in exon 3; primer 2, GACTTTCCCAGGACTGTGTCTCTTGC,
corresponding to 1235 to 1260 in Fig. 2A; or primer 3, AGGCTGTTG
GAACGCTGACCATAGAGATATC, spanning the exon 1/exon 2 splice
junction at 2461 to 2450 (exon 1) and 1302 to 1320 (exon 2) in Fig. 2A.
Purified primer extension products were separated on a 6-M urea/6% polyacrylamide gel in parallel with sequencing ladders prepared using the same
primers.
Total RNA (10 mg) from the indicated cells was separated on a 1% formaldehyde/agarose gel, transferred to a nylon membrane, and subjected to
hybridization using 32P-labeled p35 or hypoxanthine phosphoribosyltransferase (HPRT) cDNA probes. Transcript levels were analyzed by phosphorimaging (Molecular Dynamics, Sunnyvale, CA) and autoradiography.
Materials and Methods
Cell culture
The Pro1 and Pro3 promoter fragments were made by amplification of a
0.81-kb fragment (Pro1, 2458 to 1354 in Fig. 2A) or a 0.72-kb fragment
(Pro3, 2458 to 1265 in Fig. 2A) by PCR. The Pro2 promoter fragment was
made by mutation of the ATG codon (1288 to 1290 in Fig. 2A) to an ATC
in the Pro1 fragment by PCR. Amplified fragments were introduced into
the pGL3-Enhancer Vector (Promega, Madison, WI) upstream of the luciferase gene.
The p35 59 UTR fragments were made by PCR amplification using the
antisense primer P33 (CGTGGTCGACCCATGGTGGACCGGCACT
GAGAGGAG) for fragments pII, pIIa, pIV, pIVa, pIII, and pIIIc or the
antisense primer P33F (CGTGGTCGACCCATGGTGGCCGGCACT
GAGAGGAG) for fragments pIIIa and pIIIb. Primers P33 and P33F correspond to 1340 to 1375 in Fig. 2A and contain an NcoI site (underlined).
Primer P33F contains a 21 frame shift at 1356. The sense primers used
were as follows: pII, GACAAAGCTTAAAATGTGTCTCCCAAGGTC
AGC; or pIIa, GACAAAGCTTAAAATCTGTCTCCCAAGGTCAGC,
both corresponding to 1275 to 1307 in Fig. 2A; pIV, GACAAGCT
TGTCCTTGAGATGTAGAG; or pIVa, GACAAGCTTGTCCTTGAGAT
CTAGAG, both corresponding to 1196 to 1221 in Fig. 2A; pIII/pIIIa,
CATCCAAGCTTATCTCTATGGTCAGCGTTCC for the construction of
pIII and pIIIa; or pIIIb/pIIIc, CATCCAAGCTTATCTCTATCGTCAG
CGTTCC for the construction of pIIIb and pIIIc, both spanning the exon
1/exon 2 splice junction at 2469 to 2450 (exon 1) and 1302 to 1312
(exon 2) in Fig. 2A. All sense primers contain a HindIII site (underlined),
and the pIIa, pIVa, and pIIIb/pIIIc primers contain an ATG to ATC mutation (boldface). Fragments pIVb and pIVc were made by PCR mutation
of the ATG sequence (1288 to 1290 in Fig. 2A) to an ATC in fragments
pIV and pIVa, respectively. Fragments pIII, pIIIa, pIIIb, and pIIIc were
amplified on an exon 1-containing cDNA template, while all other fragments were amplified on a genomic template. All amplified products were
then digested with HindIII/NcoI and introduced into the pGL3-Control
Vector (Promega) upstream of the luciferase gene.
Cell transfection and luciferase assay
Transfection was performed by electroporation at 960 mF and 0.30 kV
(A20) or 0.32 kV (RAW 264), using 2 3 107 cells, 2 mg of pRL-TK Vector
(Promega) as an internal control, and either 10 mg (promoter assays) or 20
mg (59 UTR/translation assays) of reporter plasmid DNA per transfection.
When required, cells were stimulated with LPS at 6 h post-transfection; all
cells were harvested at 48 h post-transfection. Cell lysates were prepared
and assayed for firefly and Renilla luciferase activities using the Dual Luciferase Assay Kit (Promega). Firefly luciferase activities were normalized
to internal control Renilla luciferase values. Luciferase assays were performed at least three times.
Construction of p35/ATG stable transfectants
The full length coding region of p35 was amplified by PCR using an antisense primer specific for the 39 end of the coding region and sense primers
specific to the different 59 UTRs of p35, resulting in the following fragments: 35.I (59 end corresponding to 1359 in Fig. 2A), 35.II (59 end cor-
The bioassay for IL-12-induced IFN-g production was performed as previously described (28), using splenocytes from CBA/Ca mice and the
mAbs C15.6.7 and C15.1.2 for capture of IL-12 and, when required, the
mAb C17.8 for neutralization. IFN-g production was measured by ELISA.
IL-12 mAbs were a gift from Dr. G. Trinchieri (Wistar Institute, Philadelphia, PA).
Rapid amplification of cDNA ends (RACE)
RACE was performed as previously described (25) but with the following
modifications. First-strand cDNA was synthesized using the SMART PCR
cDNA Library Construction Kit (Clontech, Palo Alto, CA) according to the
manufacturer’s specifications. The sense primer used in semi-nested PCR was
a modified SMART primer containing an XbaI site (underlined): CAGTCTA
GATACGGCTGAGAGAAGACGACAGAA. The semi-nested antisense
primers both correspond to sequences located in exon 3 and have been previously described (25).
Semiquantitative RT-PCR
PCR amplification was performed for 18 cycles (p40, HPRT, p35 II/IV), 22
cycles (p35 I-IV), or 34 cycles (p35 III). These cycle numbers were experimentally determined to be in the linear range of amplification and detection for all cDNAs tested. The p35 I-IV, p35 II/IV, and p35 III fragments were amplified using the sense primers PI-IV (GGCAT
CCAGCAGCTCCTCTCAGTGC, corresponding to 1328 to 1352 in Fig.
2A), PII/IV (GGAAAGTCCTGCCGGCTATCCAGAC, corresponding to
1253 to 1277 in Fig. 2A), and PIII (GTGCACATCCAAGGATATCTC
TATG, corresponding to 2474 to 2450 in Fig. 2A), respectively, and a
common antisense primer P35C2 (CTGTGGGGGCAGGCAGCTCCC,
corresponding to a sequence in exon 6). The p40 and HPRT primers have
been previously described (29). Amplified products were analyzed by
Southern blot hybridization using 32P-labeled cDNA probes. Transcript
levels were analyzed by phosphorimaging and autoradiography.
Results
Translational regulation is involved in the control of IL-12 p35
expression
We previously mapped the p35 transcription start sites in the murine macrophage cell line WEHI-3D by 59 RACE (25). Start sites
were located in both exon 1, a 59 noncoding exon, and in exon 2,
which contains the ATG that encodes the first methionine of p35.
Primer extension analysis in the murine B cell line A20 has identified four major transcription start sites in the intron region directly upstream of exon 2 (26). Taken together, these mapping
studies suggest that p35 transcription might be driven by two promoters, one upstream of exon 1 and one upstream of exon 2. Promoter activity has been detected in a 1.8-kb fragment containing
both putative promoters (26). To further characterize this promoter
region, we analyzed the 59 flanking region of exon 2 (containing
intron 1 only) for promoter activity using a luciferase reporter
assay. A 0.81-kb fragment spanning the 59 end of intron 1 to just
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
Construction of promoter and p35 59 UTR-containing luciferase
reporter plasmids
IL-12 bioassay
The Journal of Immunology
4071
90-bp region (containing ATG2) from the 39 end of the Pro1 promoter fragment. In nonstimulated and LPS-stimulated A20 cells,
both reporter plasmids exhibited fivefold greater luciferase activity
than that observed with the pGL3-Enhancer Vector alone (Fig. 1).
Mutating ATG4 in the Pro2 construct to an ATC codon did not
result in a further increase in luciferase activity (data not shown).
These results suggest that promoter activity is located upstream of
exon 2, and that the presence of ATG2 in the p35–59 UTR/luciferase mRNA inhibits downstream translation of the luciferase protein. Furthermore, in the 90-bp region deleted from Pro1 to Pro3,
a typical TATA box sequence (TATAAAA) is present. Deletion of
this 90-bp region in Pro3 did not result in a decrease in promoter
activity, suggesting that p35 transcription from upstream of exon 2
is controlled by a TATA-less promoter.
Multiple transcription start sites result in the production of
different mRNA isoforms
before the first ATG of p35 was introduced upstream of the luciferase reporter gene in the pGL3-Basic Vector and assayed for luciferase activity in A20 cells under nonstimulated and LPS-stimulated conditions. No promoter activity was detected using this
reporter construct, even after LPS stimulation (data not shown).
Since p35 transcripts are usually expressed at low levels (1), it is
likely that the p35 promoter is relatively weak. Therefore, we inserted the same 0.81-kb fragment into the pGL3-Enhancer Vector,
which contains an SV40 enhancer downstream of the luciferase
gene. Promoter activity was assayed using this construct (Pro1)
and compared with levels produced using pGL3-Enhancer Vector
alone. Surprisingly, again no promoter activity was detected in this
fragment, even after LPS stimulation (Fig. 1).
Since p35 mapping studies indicate that there are major transcription start sites in intron 1 and exon 2, we would expect that
promoter activity would be located in the 59 flanking region of
these start sites. Therefore, in light of the fact that no promoter
activity could be detected in this region, we analyzed the DNA
sequence of our promoter fragment for possible regulatory elements. Interestingly, we identified two additional ATGs upstream
of the ATG that encodes the first methionine of p35 (designated
ATG1) (Fig. 2A). One ATG (designated ATG2) is located 74 bp
upstream of ATG1, and the other (designated ATG4) is located
148 bp upstream of ATG1. Since upstream ATGs located in the 59
UTR often inhibit translation from a downstream ATG (30, 31),
we predicted that, given transcription of the luciferase mRNA
(containing the p35 59 UTR) driven by the p35 promoter fragment,
the presence of these additional ATGs might inhibit downstream
translation from the first ATG of luciferase. Transcription initiation sites in A20 were mapped upstream of ATG4 by primer extension (26), indicating that ATG2 and ATG4 are present in the
p35–59 UTR/luciferase mRNA transcribed from the Pro1 reporter
plasmid. To examine the effects of these upstream ATGs, we constructed two additional reporter plasmids using the pGL3-Enhancer Vector: Pro2 was made by mutating ATG2 in the Pro1
fragment to an ATC codon, and Pro3 was made by deleting a
Given that ATG2 can inhibit translation from the first ATG in the
luciferase gene, it seemed likely that ATG2 could also inhibit
translation from the first ATG in the p35 gene. It was important,
therefore, to further analyze the different isoforms of p35 for the
presence of ATG2 and/or other upstream ATGs. From previous 59
mRNA mapping studies (25, 26), four possible mRNA isoforms
can be defined based on the position and number of ATGs upstream of ATG1 in the 59 UTR (Fig. 2, A and B). We have previously defined three of these isoforms (25): type I transcripts initiate from exon 2 and contain no additional ATG sequences; type
II transcripts initiate from intron 1 and contain ATG2; and type III
transcripts initiate from exon 1 and contain an additional ATG,
designated ATG3, located 63 bp upstream of ATG1. Based on the
primer extension results reported for the A20 cell line (26), we
now define a new type of mRNA isoform, the type IV transcript,
which initiates further upstream in intron 1 and contains ATG2 and
ATG4. The open reading frames (ORFs) initiated by each upstream ATG are shown in Fig. 2C. ATG1 encodes the first methionine of the p35 protein. ATG2 is out-of-frame relative to ATG1
and initiates an ORF of 40 amino acids (aa), which terminates
downstream of ATG1. ATG3 is in-frame relative to ATG1 and so
initiates an ORF containing an additional 21 aa at the N-terminus
of the p35 protein. ATG4 is followed directly by a stop codon, and
so initiates an ORF of only 1 aa.
In the primer extension assay used to identify the type IV transcripts in A20 cells (26), the primer binding region was located
upstream of ATG2 in a position unsuitable for the detection of type
I, II, and III transcripts. To determine whether these transcripts
were synthesized in A20 cells, we performed primer extension
analysis using three different primers on mRNA from nonstimulated and LPS-stimulated A20 cells (Fig. 3). The binding regions
of these three primers are shown in Fig. 3C. The binding region of
primer 1 was located in exon 3 for detection of all isoforms of p35
mRNA, the binding region of primer 2 was located upstream of
ATG2 for detection of both type II and type IV transcripts, and the
binding region of primer 3 spanned the exon 1/exon 2 splice junction for detection of only type III transcripts.
Using primer 3, no extension products were detected in A20
cells, suggesting that type III transcripts are not a significant fraction of the p35 mRNA population in these cells. Using primer 1,
extension products in both nonstimulated and LPS-stimulated A20
cells were located 215, 234, and 331 bp from the 59 end of the
primer (Fig. 3A). Since no extension products could be detected in
exon 1 using primer 3, it was assumed that these transcription start
sites were located in intron 1. The 331-bp extension product was
the major start site detected using this primer. Using primer 2, this
major start site was again identified as well as an additional start
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 1. Promoter activity in the 59 flanking region of exon 2. Luciferase reporter plasmids were constructed by insertion of p35 fragments
containing the 59 flanking region of exon 2 into the pGL3-Enhancer Vector
upstream of the luciferase gene. A20 cells were transiently transfected with
10 mg of reporter plasmid and, when required, stimulated with LPS after
transfection. Firefly luciferase levels were normalized to internal control
Renilla luciferase values, and compared with the levels of luciferase produced using pGL3-Enhancer Vector alone. Results are presented as the
mean value of at least three experiments.
4072
REGULATION OF IL-12 EXPRESSION BY TRANSLATIONAL CONTROL OF p35
site (showing the same band intensity) located 94 bp upstream
(Fig. 3B). These results suggest that the two more 59 start sites are
the major sites of p35 transcription initiation in A20 cells. These
are designated 11 and 195, respectively, with the more 39 start
sites identified using primer 1 numbered accordingly (1192 and
1211). The precise locations of these start sites are shown in Fig.
2A. Our primer extension results thus confirm the location of start
sites identified previously (26) and, furthermore, indicate that in
both nonstimulated and LPS-stimulated A20 cells, p35 transcription occurs mainly from upstream of ATG4. Therefore, the type IV
transcript (containing ATG2 and ATG4) is the predominant form
of p35 message in this cell line.
The presence of ATG2, but not ATG3 or ATG4, in the 59 UTR
of p35 transcripts inhibits translation from p35 ATG1
Our results to date suggest that the presence of ATG2 in a transcript can inhibit translation from a downstream ATG, and that
ATG2 is present in the 59 UTR of a high proportion of p35 transcripts. To further define the role of ATG2 and the other upstream
ATGs in p35 expression, we used a luciferase reporter system
similar to that used in our promoter assay to measure the effect of
these multiple ATGs on translation from ATG1. The p35 cDNA
fragments containing ATG1 and upstream ATG sequences were
introduced upstream of the luciferase reporter gene under control
of the SV40 promoter in the pGL3-Control Vector. The structure
of reporter plasmids is shown in Fig. 4. The first ATG of luciferase
was “replaced” by the ATG1 of p35 in all reporter plasmids. To
determine the effect of ATG2 and ATG4 on translation from
ATG1, these upstream ATGs were, in some constructs, mutated to
ATC codons either independently or in combination. Because
ATG3 is in-frame with ATG1, translation from this upstream ATG
would introduce an additional 21 aa at the N-terminus of the luciferase protein. Luciferase proteins with these additional 21 aa
might retain activity, and so a detectable difference in luciferase
activity might not be observed as a result of translation from
ATG3. Thus, to assay the efficiency of translation from ATG3 we
introduced a 21 frame shift upstream of ATG1 so that, as in constructs containing ATG2, translation from ATG3 is out-of-frame
with ATG1. Reporter plasmids were transiently transfected into
both A20 cells and the murine macrophage cell line RAW 264 and
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 2. Structure of the 59 region of the p35 gene. A, Nucleotide sequences of exon 1, intron 1, and exon 2. Transcription start sites detected by
primer extension are indicated by closed arrowheads. Start sites downstream of ATG2 detected by RACE are indicated by open arrowheads. Exons and
ATG sequences are boxed, and the typical TATA box sequence is underlined. B, mRNA isoforms defined by multiple transcription initiation sites. C, ORFs
initiating from upstream ATGs.
The Journal of Immunology
assayed for luciferase activity under nonstimulated and LPS-stimulated conditions (Fig. 4). Luciferase levels were measured relative to the level of luciferase produced by the pGL3-Control Vector, which contained the SV40 promoter but no p35 59 UTR insert.
Reporter plasmids containing ATG2 (Fig. 4; pII, pIV, and pIVa)
produced little or no luciferase activity in all cell types analyzed.
When ATG2 was mutated to an ATC codon in these plasmids (Fig.
4; pIIa, pIVb, and pIVc, respectively), luciferase activity was re-
FIGURE 4. Luciferase assay measuring the effect of upstream ATGs on
translation from ATG1 in the p35 gene. Luciferase reporter plasmids were
constructed by the insertion of p35 59 UTR fragments into the pGL3Control Vector upstream of the luciferase gene. A20 and RAW 264 cells
were transiently transfected with 20 mg of reporter plasmid and, when
required, stimulated with LPS after transfection. Firefly luciferase levels
were normalized to internal control Renilla luciferase values, and compared with the levels of luciferase produced using pGL3-Control Vector
alone. Background luciferase levels were measured using pGL3-Basic
Vector (no promoter) alone. Results are presented as the mean value of at
least three experiments.
stored to the level in the pGL3-Control. Thus, the presence of
ATG2 inhibits translation from ATG1, and luciferase production is
rescued by the mutation of this ATG to an ATC. Mutating ATG4
to an ATC codon had no effect on luciferase activity in any plasmid tested (Fig. 4; pIV-pIVc). Similarly, the presence or the absence of ATG3 had no effect on luciferase activity (Fig. 4; pIIIpIIIc), even when in combination with a 21 frame shift (Fig. 4;
pIIIa and pIIIb). Taken together, these results indicate that in both
nonstimulated and LPS-stimulated cells, the presence of ATG2,
but not ATG3 or ATG4, inhibits translation from ATG1 in p35–59
UTR/luciferase mRNAs. This strongly suggests that only the type
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 3. Mapping of p35 transcription start sites by primer extension. Twenty micrograms of poly(A)1 RNA from nonstimulated and LPSstimulated A20 cells or 20 mg of yeast transfer RNA as a negative control
were analyzed by primer extension using primer 1 (A), located in exon 3,
or primer 2 (B), located in intron 1 between ATG2 and ATG4. Sequencing
ladders were prepared using the same primers and were run in parallel with
primer extension products. The positions of transcription start sties are
denoted by arrows. The most 59 major start site is defined as 11. C, The
relative locations of primers, transcription start sites, and upstream ATGs
are shown.
4073
4074
REGULATION OF IL-12 EXPRESSION BY TRANSLATIONAL CONTROL OF p35
The proportion of type I transcripts in the p35 mRNA
population is up-regulated after LPS stimulation
FIGURE 5. Bioassay measuring IL-12-induced IFN-g production. A,
Ten micrograms of total RNA from LPS-stimulated stable transfectants
and RAW 264 untransfected cells was analyzed by Northern blot hybridization using 32P-labeled cDNA probes for p35 and HPRT. B, Supernatants
from these cells were assayed for the presence of functional IL-12 by a
bioassay measuring IFN-g production from spleen cells. When required,
splenocytes were cultured in the presence of a neutralizing anti-IL-12 mAb.
Results are presented as the mean value of two experiments, each in duplicate wells, assayed on the same microtiter plate. The bioassay was performed five times with similar results.
I and type III transcripts (those not containing ATG2) are capable
of supporting translation of the p35 subunit.
To confirm these results, we examined the production of bioactive IL-12 from transfectants containing type I, type II, type III, or
a mutant type III p35 transcript. The entire p35 coding region and
59 UTR containing ATG1 alone (Fig. 5, 35.I), ATG1 and ATG2
(Fig. 5; 35.II), ATG1 and ATG3 (Fig. 5; 35.III), or ATG3 and an
ATG1 to GCG mutation (Fig. 5; 35.IIIa) were introduced into the
mammalian expression vector pOXCD59neo under control of the
constitutive EF-1a promoter. Stable transfectants were generated
in the RAW 264 cell line, which after LPS stimulation produces
Our bioassay results suggest that biologically significant amounts
of the p35 subunit and IL-12 heterodimer can only be produced
when type I and type III transcripts are present. By primer extension assay, however, we have shown that in both nonstimulated
and LPS-stimulated A20 cells, the major type of p35 mRNA synthesized is the type IV transcript. This apparent paradox can be
explained if we consider the possibility that minor start sites that
represent transcripts not containing ATG2 may have been missed
by primer extension analysis. We therefore sought to further analyze the p35 mRNA populations of these cells using the RACE
method of 59 mRNA mapping (32) to identify any minor start sites.
To ensure the selective amplification of full-length cDNA products, we used the cap-dependent SMART cDNA synthesis method,
which has been used in conjunction with RACE for mapping the 59
ends of other genes (33, 34).
This RACE method was used to characterize the mRNA populations of nonstimulated and LPS-stimulated A20 cells and bmDC,
which are physiological producers of IL-12 (4, 35). To reduce the
likelihood that our results were biased by PCR amplification, two
independent experiments were performed on the same mRNA
sample, and similar results were obtained in each. Approximately
60 –70 clones in total from each cell type were analyzed and sequenced (Fig. 6). Multiple start sites, including the 195, 1192,
and 1211 start sites identified by primer extension, were found in
all cell types tested. These start sites were clustered within intron
1 (from 195 to 1278) or within exon 2 (from 1311 to 1347) and
could be classified according to the position of the start site relative
to ATG2: 1) those start sites upstream of ATG2 that result in type
II or type IV transcripts (nonfunctional mRNA for p35 translation),
and 2) those start sites downstream of ATG2 that result in type I
transcripts (functional mRNA for p35 translation). In nonstimulated A20 cells, all transcripts initiated upstream of ATG2 (type II
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
high levels of p40 mRNA but little or no detectable p35 mRNA.
Expression levels of the p35 transgene were similar in all transfectants and undetectable in untransfected RAW 264 cells, as measured by Northern blot hybridization (Fig. 5A) and phosphorimager analysis (data not shown). Supernatants from LPS-stimulated
transfectants and untransfected RAW cells were tested in an IL-12
bioassay for the ability to induce IFN-g production from spleen
cells (Fig. 5B). Untransfected RAW cells did not induce any IFN-g
production, consistent with the fact that endogenous p35 levels in
this cell line are too low to contribute to IL-12 production. Only
the supernatants from transfectants 35.I and 35.III were capable of
inducing high levels of IFN-g. This IFN-g induction was a result
of the presence of bioactive IL-12 in supernatants, since IFN-g
production was completely abrogated by the addition of a neutralizing anti-IL-12 mAb. This confirmed our previous findings that
the presence of ATG2 in p35 mRNA almost completely inhibits
translation from ATG1. In contrast, the presence of ATG3 in transfectant 35.III had no effect on the production of p35, since IL-12
levels in this transfectant were similar to those secreted by transfectant 35.I. This was consistent with our luciferase assay result,
which indicated that no translation occurred from ATG3. There
was a small possibility that in transfectant 35.III, translation initiated from ATG3 but that the additional 21 aa at the N-terminus of
the p35 protein had no effect on p35 secretion/function. To exclude
this possibility, ATG1 was mutated to an alanine codon (GCG) in
construct 35.III to make construct 35.IIIa. No IL-12 activity was
detected in the supernatant from this transfectant, confirming our
previous observation that initiation of translation does not occur
from ATG3.
The Journal of Immunology
or type IV transcripts). After LPS stimulation, however, the proportion of type I transcripts was up-regulated to 7.0% of the p35
mRNA population. In nonstimulated bmDC, 1.7% of transcripts
initiated from downstream of ATG2, and this was up-regulated to
16.4% after LPS stimulation. Some of these transcripts, particularly type I transcripts, were not previously detected in A20 cells
because 59 mapping in this cell line was performed using the less
sensitive primer extension method. These results indicate that in
both A20 and bmDC, LPS stimulation up-regulates the proportion
of type I transcripts (functional mRNA for p35 translation) within
the p35 mRNA population.
Three start sites downstream of ATG2 were detected, and these
were located at 1311, 1330, and 1347 (open arrowheads in Fig.
2A). These three start sites correlate within several bases of the
three exon 2 start sites identified in the WEHI-3D cell line in our
previous study (25).
p35 transcription can initiate from exon 1 after LPS stimulation
We had previously identified the presence of type III transcripts in
WEHI-3D cells (25), yet by RACE 59 mapping in A20 and bmDC,
no transcripts of this type were detected. We considered the possibility that in these cells, type III transcripts might represent an
FIGURE 7. Semiquantitative RT-PCR analysis of p35 mRNA populations. To characterize the p35 mRNA populations from nonstimulated and
LPS-stimulated A20 and bmDC, sense primers were chosen whose binding
regions were located upstream of ATG1 to identify all forms of p35 transcripts (p35 I–IV), upstream of ATG2 to identify only type II or type IV
transcripts (p35 II/IV), or upstream of ATG3 to identify only type III transcripts (p35 III). mRNA levels of p40 and HPRT were also determined.
Thermal cycling was performed for 18 cycles (p40, HPRT, p35 II/IV), 22
cycles (p35 I–IV), or 34 cycles (p35 III). Amplified products were analyzed
by Southern blot hybridization using 32P-labeled cDNA probes. The results
shown are representative of at least three experiments.
even smaller fraction of the mRNA population than do type I transcripts. To explore this possibility, we performed semiquantitative
RT-PCR on mRNA from nonstimulated and LPS-stimulated A20
and bmDC (Fig. 7). To characterize the p35 mRNA populations in
these cells, p35 sense primers were chosen whose binding sites
were located either upstream of ATG1 to identify all p35 isoforms
(Fig. 7, p35 I–IV), upstream of ATG2 to identify only the type II
or type IV isoforms (Fig. 7, p35 II/IV), or upstream of ATG3 to
identify only type III isoforms (Fig. 7, p35 III). Type II and type
IV transcripts cannot be differentiated using these primers. mRNA
levels of p40 and the housekeeping gene HPRT were also determined. Transcript levels were determined by phosphorimager analysis and normalized to HPRT levels.
The p35 transcripts (p35 I-IV and p35 II/IV) were detected in
nonstimulated A20 and bmDC. After stimulation, these messages
were up-regulated by 3.6- and 4.4-fold, respectively, in A20 cells,
and by 7.1- and 6.2-fold, respectively, in bmDC. In both cell types,
type III transcripts were detected only after LPS stimulation. To
ensure that the p35 type III band was not an artifact, this band was
cloned, and the type III sequence was confirmed. The substantial
up-regulation of all p35 isoforms observed after LPS stimulation
suggests that transcriptional mechanisms also play a role in p35
gene regulation.
By RACE and RT-PCR, we have shown that LPS-stimulated
bmDC can produce functional mRNA for translation of p35 (type
I and type III transcripts). These cells also synthesize p40 transcripts after LPS stimulation (Fig. 7) and thus can produce IL-12
heterodimer. A20 cells differ from bmDC in their ability to produce IL-12 because they do not synthesize p40 mRNA, even after
LPS stimulation (Fig. 7). However, because A20 and bmDC have
a similar pattern of p35 expression, and because it has been shown
that p35 and p40 are regulated independently (11–14), A20 is a
good and useful model for the study of p35 gene regulation.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 6. Determination of the proportion of type I and type II/IV
transcripts in the p35 mRNA population by 59 RACE. mRNAs from nonstimulated and LPS-stimulated A20 and bmDC were reverse transcribed
using the cap-dependent SMART cDNA synthesis method. The p35 59 end
was then amplified from first-strand cDNA by semi-nested PCR using p35specific primers. To reduce the likelihood that the results were biased by
PCR amplification, two independent experiments were performed on the
same mRNA sample. Multiple transcription start sites were identified in all
cell types and were classified based on their positions relative to ATG2.
The number of clones starting upstream of ATG2 (type II/IV transcripts,
nonfunctional mRNA for p35 translation) and downstream of ATG2 (type
I transcripts, functional mRNA for p35 translation) in each cell type are
shown. The relative number of type I transcripts is shown in parentheses.
The sequence range spanned by each cluster of start sites is indicated above
the schematic drawing of the p35 59 region (numbering as in Fig. 2A).
4075
4076
REGULATION OF IL-12 EXPRESSION BY TRANSLATIONAL CONTROL OF p35
Discussion
In the present study, we demonstrate that p35 expression is controlled 1) by transcriptional regulation, in terms of both the expression level and the type of p35 mRNA isoform transcribed; and
2) by translational control, in which the presence of an upstream
ATG in the 59 UTR of p35 mRNA inhibits translation of the p35
subunit. The translational and transcriptional mechanisms employed in p35 regulation are intimately linked, such that the negative translational controls exerted under nonstimulated conditions
can be bypassed, after LPS stimulation, by a switch in the location
of transcription initiation. This type of regulation has also been
observed in other genes, including the murine complement factor
B gene (36) and the IL-15 gene (37).
IL-12 gene regulation occurs at many levels. Coexpression of
both subunits in the same cell is required to produce bioactive
IL-12 heterodimer (10), yet these subunits are controlled independently (11–14). We have shown here that the p35 gene is highly
regulated at the level of translation by the presence or the absence
of an upstream ATG in the 59 UTR. The majority of genes containing upstream ATGs are cytokines, cytokine receptors, growth
factors, transcription factors, signal transduction molecules, and
proto-oncogenes (31). These molecules, when overproduced,
might constitute a potential danger to the host. Therefore, it seems
likely that the reason why IL-12 expression is so tightly controlled
is to ensure that enough safeguards are in place to prevent overproduction of this potentially dangerous cytokine. Furthermore,
the independent regulation of the IL-12 subunits allows, in theory,
for safe expression of only one subunit at a time (2, 16, 17, 38, 39).
Thus, it is possible that during development, the IL-12 subunits are
expressed one at a time to generate self tolerance without putting
the host in the position of having to achieve immunological tolerance to a cytokine that itself counteracts tolerance (40).
We have demonstrated p35 promoter activity upstream of exon
2. This promoter activity is quite weak compared with that of the
p40 gene (18, 19, 23) (M. Tone, unpublished observations). This
may reflect an additional mechanism to prevent overproduction of
IL-12. However, this would seem a disadvantage for a cell when it
needs to rapidly induce expression of the IL-12 protein. The translational control of the p35 subunit may play a role here, whereby
the continued synthesis of untranslatable p35 message would
maintain the transcriptional locus in an open and active state, with
the basal transcription machinery and most or all transcription fac-
tors already recruited and in place. The cell would only need to
shift its site of transcriptional initiation so as to synthesize type I
and/or type III transcripts (functional mRNA for p35 translation).
Maintaining the transcription locus in an open form has also been
suggested as a mechanism for the rapid induction of transcription
in the IL-2 gene (41, 42). In resting T cells, the RNA polymerase
is “paused” but not active at the start site of transcription, and only
becomes active upon assembly of other enhancer/promoter elements upon T cell activation.
Synthesis of type II and type IV transcripts seems to be controlled by a TATA-less promoter. Promoter activity upstream of
exon 2 is not dependent upon the presence of the TATA sequence
(Fig. 1, Pro3), and in addition, this typical TATA sequence is
located at position 1281 to 1287 in the p35 gene, far downstream
of the type II and type IV transcription start sites. However, after
LPS stimulation, transcription can initiate from three start sites in
exon 2, and the major start site is located at position 1311, 30 bp
downstream of the TATA box. It is possible, therefore, that the
TATA box functions only after LPS stimulation and may play a
role in the switching of transcriptional initiation to downstream of
ATG2. It is of interest that a structurally related cytokine, IL-6 (25,
43), contains a functional TATA-like sequence in a position similar to that of the TATA box in p35 (25). Thus, it is likely that the
TATA box in the p35 gene was at one time functional and may still
continue to play a well-defined role in the regulation of p35 gene
expression.
The translational mechanism of p35 regulation defined here can
explain why, in some cases, the coexpression of p35 and p40 messages is not sufficient to produce IL-12 heterodimer (16, 17, 38,
39). For example, when macrophages from BALB/c mice are infected by Salmonella dublin, there is a significant up-regulation of
both p35 and p40 mRNA (15). However, while the p40 subunit
was readily detected in cultures of infected macrophages, no IL-12
protein was observed (38). Pretreatment of macrophages with
IFN-g, however, led to an increase in IL-12 protein production
after Salmonella infection. Thus, it is likely that in this system,
IFN-g can induce a shift in transcription initiation in p35 so that
the type I and/or type III transcripts (functional mRNA for p35
translation) are synthesized. Similarly, it has been reported that in
microglia (17), the resident macrophage of the brain, and astrocytes (39), the major glial cell type in the central nervous system,
LPS stimulation induces the expression of both p35 and p40
mRNA but not that of IL-12 protein. Only after a combination of
LPS/IFN-g treatments can any IL-12 heterodimer be detected in
these cell cultures.
We have shown previously that LPS stimulation was sufficient
to up-regulate the transcription of p35 type I and type III mRNA
isoforms from the macrophage cell line WEHI-3D (25), and here
we report a similar finding in A20 cells and bmDC. However, in
the case of Salmonella-infected macrophages and LPS-stimulated
astrocytes and microglia, a single stimulus was not sufficient to
drive the production of IL-12 from these cells. Only the combined
treatment of LPS/IFN-g could induce IL-12 secretion. Thus, the
mechanism driving the switch in p35 transcription to make type I
and/or type III transcripts is likely to depend on both the nature of
the stimulus and the type of responding cell. In addition, the importance of CD40 ligation for the induction of IL-12 from APCs
has been demonstrated (7), and its role, if any, in the switching of
transcription initiation in p35 should be examined. We expect that
CD40 ligation will induce a similar change in the type of p35
message transcribed by APCs.
Although translational control is a potent mechanism of gene
regulation, we cannot rule out the possibility that the type II and
type IV transcripts might have another function aside from serving
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
Since the type I-IV, type II/IV, and type III mRNA isoforms
were detected using different primer pairs, we cannot quantify the
relative proportions of these transcripts in the p35 mRNA population from these RT-PCR results. However, our RACE data indicate that type II/IV transcripts are a significant portion of the p35
mRNA population before and after LPS stimulation in both cell
types. Furthermore, the absence of type III transcripts in our
RACE pool of 59 clones suggests that type III transcripts are a rare
population of mRNAs in LPS-stimulated A20 and bmDC. Taken
together with our RACE and primer extension data, these RT-PCR
results clearly demonstrate that nonstimulated cells synthesize
transcripts that initiate almost entirely from upstream of ATG2
(type II and type IV transcripts, nonfunctional for p35 translation),
and upon LPS stimulation there is a shift in transcription initiation
so that cells synthesize a higher proportion of transcripts that do
not contain ATG2 (type I and type III transcripts, functional
mRNA for p35 translation). These type I and type III mRNA isoforms, according to our luciferase assay and IL-12 bioassay results, can support translation of the p35 subunit and its incorporation into the IL-12 heterodimer.
The Journal of Immunology
Acknowledgments
We thank Sara Thompson for assistance in performing DNA sequencing,
and Mark Frewin for technical assistance.
References
1. Trinchieri, G. 1995. Interleukin 12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive
immunity. Annu. Rev. Immunol. 13:251.
2. D’Andrea, A., M. Rengaraju, N. M. Valiante, J. Chehimi, M. Kubin, M. Aste,
S. H. Chan, M. Kobayashi, D. Young, E. Nickbarg, et al. 1992. Production of
natural killer cell stimulatory factor (interleukin 12) by peripheral blood mononuclear cells. J. Exp. Med. 176:1387.
3. Macatonia, S. E., N. A. Hosken, M. Litton, P. Vieira, C. S. Hsieh,
J. A. Culpepper, M. Wysocka, G. Trinchieri, K. M. Murphy, and A. O’Garra.
1995. Dendritic cells produce IL-12 and direct the development of Th1 cells from
naive CD41 T cells. J. Immunol. 154:5071.
4. Heufler, C., F. Koch, U. Stanzl, G. Topar, M. Wysocka, G. Trinchieri, A. Enk,
R. M. Steinman, N. Romani, and G. Schuler. 1996. Interleukin-12 is produced by
dendritic cells and mediates T helper 1 development as well as interferon-g production by T helper 1 cells. Eur. J. Immunol. 26:659.
5. Sypek, J. P., C. L. Chung, S. E. H. Mayor, J. M. Subramanyam, S. J. Goldman,
D. S. Sieburth, S. F. Wolf, and R. G. Schaub. 1993. Resolution of cutaneous
leishmaniasis: interleukin-12 initiates a protective T helper type I immune response. J. Exp. Med. 177:1797.
6. Gazzinelli, R. T., S. Hieny, T. A. Wynn, S. Wolf, and A. Sher. 1993. Interleukin-12 is required for the T lymphocyte-independent induction of interferon-g by
an intracellular parasite and induces resistance in T cell-deficient hosts. Proc.
Natl. Acad. Sci. USA 90:6115.
7. Shu, U., M. Kiniwa, C. Y. Wu, C. Maliszewski, N. Vezzio, J. Hakimi, M. Gately,
and G. Delespesse. 1995. Activated T cells induce interleukin-12 production by
monocytes via CD40-CD40 ligand interaction. Eur. J. Immunol. 25:1125.
8. Gately, M. K., L. M. Renzetti, J. Magram, A. S. Stern, L. Adorini, U. Gubler, and
D. H. Presky. 1998. The interleukin-12/interleukin-12-receptor system: role in
normal and pathologic immune responses. Annu. Rev. Immunol. 16:495.
9. Kobayashi, M., L. Fitz, M. Ryan, R. M. Hewick, S. C. Clark, S. Chan, R. Loudon,
F. Sherman, B. Perussia, and G. Trinchieri. 1989. Identification and purification
of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic
effects on human lymphocytes. J. Exp. Med. 170:827.
10. Gubler, U., A. O. Chua, D. S. Schoenhaut, C. M. Dwyer, W. McComas,
R. Motyka, N. Nabavi, A. G. Wolitzky, P. M. Quinn, P. C. Familletti, et al. 1991.
Coexpression of two distinct genes is required to generate secreted bioactive
cytotoxic lymphocyte maturation factor. Proc. Natl. Acad. Sci. USA 88:4143.
11. Bette, M., J. Shen-Chu, T. Germann, M. K.-H. Schäfer, E. Weihe, E. Rüde, and
B. Fleischer. 1994. Differential expression of mRNA encoding interleukin-12 p35
and p40 subunits in situ. Eur. J. Immunol. 24:2435.
12. Hayes, M. P., J. Wang, and M. A. Norcross. 1995. Regulation of interleukin-12
expression in human monocytes: selective priming by interferon-g of lipopolysaccharide-inducible p35 and p40 genes. Blood 86:646.
13. Snijders, A., C. M. U. Hilkens, T. C. T. M. van der Pouw Kraan, M. Engel,
L. A. Aarden, and M. L. Kapsenberg. 1996. Regulation of bioactive IL-12 production in lipopolysaccharide-stimulated human monocytes is determined by the
expression of the p35 subunit. J. Immunol. 156:1207.
14. Aste-Amezaga, M., X. Ma, A. Sartori, and G. Trinchieri. 1998. Molecular mechanisms of the induction of IL-12 and its inhibition by IL-10. J. Immunol. 160:
5936.
15. Chong, C., K. L. Bost, and J. D. Clements. 1996. Differential production of IL-12
mRNA by murine macrophages in response to viable or killed Salmonella spp.
Infect. Immun. 64:1154.
16. Kincy-Cain, T., and K. L. Bost. 1997. Substance P-induced IL-12 production by
murine macrophages. J. Immunol. 158:2334.
17. Aloisi, F., G. Penna, J. Cerase, B. M. Iglesias, and L. Adorini. 1997. IL-12
production by central nervous system microglia is inhibited by astrocytes. J. Immunol. 159:1604.
18. Murphy, T. L., M. G. Cleveland, P. Kulesza, J. Magram, and K. M. Murphy.
1995. Regulation of interleukin 12 p40 expression through an NF-kB half-site.
Mol. Cell. Biol. 15:5258.
19. Ma, X., J. M. Chow, G. Gri, G. Carra, F. Gerosa, S. F. Wolf, R. Dzialo, and
G. Trinchieri. 1996. The interleukin 12 p40 gene promoter is primed by interferon
g in monocytic cells. J. Exp. Med. 183:147.
20. Ma, X., M. Neurath, G. Gri, and G. Trinchieri. 1997. Identification and characterization of a novel ets-2-related nuclear complex implicated in the activation of
the human interleukin-12 p40 gene promoter. J. Biol. Chem. 272:10389.
21. Taki, S., T. Sato, K. Ogasawara, T. Fukuda, M. Sato, S. Hida, G. Suzuki,
M. Mitsuyama, E. Shin, S. Kojima, et al. 1997. Multistage regulation of Th1-type
immune responses by the transcription factor IRF-1. Immunity 6:673.
22. Scharton-Kersten, T., C. Contursi, A. Masumi, A. Sher, and K. Ozato. 1997.
Interferon consensus sequence binding protein-deficient mice display impaired
resistance to intracellular infection due to a primary defect in interleukin 12 p40
induction. J. Exp. Med. 186:1523.
23. Plevy, S. E., J. H. M. Gemberling, S. Hsu, A. J. Dorner, and S. T. Smale. 1997.
Multiple control elements mediate activation of the murine and human interleukin
12 p40 promoters: evidence of functional synergy between C/EBP and Rel proteins. Mol. Cell. Biol. 17:4572.
24. Schoenhaut, D. S., A. O. Chua, A. G. Wolitzky, P. M. Quinn, C. M. Dwyer,
W. McComas, P. C. Familletti, M. K. Gately, and U. Gubler. 1992. Cloning and
expression of murine IL-12. J. Immunol. 148:3433.
25. Tone, Y., S. A. J. Thompson, J. M. Babik, K. F. Nolan, M. Tone, C. Raven, and
H. Waldmann. 1996. Structure and chromosomal location of the mouse interleukin-12 p35 and p40 subunit genes. Eur. J. Immunol. 26:1222.
26. Yoshimoto, T., K. Kojima, T. Funakoshi, Y. Endo, T. Fujita, and H. Nariuchi.
1996. Molecular cloning and characterization of murine IL-12 genes. J. Immunol.
156:1082.
27. Inaba, K., M. Inaba, N. Romani, H. Aya, M. Deguchi, S. Ikehara, S. Muramatsu,
and R. M. Steinman. 1992. Generation of large numbers of dendritic cells from
mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor. J. Exp. Med. 176:1693.
28. Wysocka, M., M. Kubin, L. Q. Vieira, L. Ozmen, G. Garotta, P. Scott, and
G. Trinchieri. 1995. Interleukin-12 is required for interferon-g production and
lethality in lipopolysaccharide-induced shock in mice. Eur. J. Immunol. 25:672.
29. Tone, M., S. A. J. Thompson, Y. Tone, P. J. Fairchild, and H. Waldmann. 1997.
Regulation of IL-18 (IFN-g-inducing factor) gene expression. J. Immunol. 159:
6156.
30. Kozak, M. 1987. An analysis of 59-noncoding sequences from 699 vertebrate
messenger mRNAs. Nucleic Acids Res. 15:8125.
31. Kozak, M. 1991. An analysis of vertebrate mRNA sequences: intimations of
translational control. J. Cell Biol. 115:887.
32. Frohman, M. A., M. K. Dush, and G. R. Martin. 1988. Rapid production of
full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85:8998.
33. Baier, M., N. Bannert, A. Werner, K. Lang, and R. Kurth. 1997. Molecular
cloning, sequence, expression, and processing if the interleukin 16 precursor.
Proc. Natl. Acad. Sci. USA 94:5273.
34. Adam, M. F., A. Belmouden, P. Binisti, A. P. Brézin, F. Valtot, A. Béchetoille,
J. Dascotte, B. Copin, L. Gomez, A. Chaventré, et al. 1997. Recurrent mutations
in a single exon encoding the evolutionarily conserved olfactomedin-homology
domain of TIGR in familial open-angle glaucoma. Hum. Mol. Genet. 6:2091.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
as a buffer of untranslatable message to prevent the overproduction
of the p35 subunit. For example, the 40-aa peptide encoded by the
ATG2 ORF may have a specific function unrelated to p35 translational control. However, database searches have not revealed any
striking similarities with known proteins (J. Babik, unpublished
observation).
Interestingly, the presence of ATG2 in the 59 UTR of p35 transcripts is conserved between human (44) and murine genes. The
favorable context for translation initiation (30) around murine
ATG2 is also exactly conserved in the human gene, so it is likely
that translation occurs from this upstream ATG in human p35
mRNA. However, in the human gene, ATG2 is in-frame with the
p35 protein, resulting in a potential additional 34-aa fragment at
the N-terminus of the p35 signal peptide. In cells transfected with
human p35 cDNA, translation of p35 occurs from constructs without the in-frame ATG2, and so the presence of this upstream ATG
is not necessary for production of the p35 subunit (44). The effect
of the in-frame ATG2 on the translational efficiency of human p35
transcripts has not been reported. It is possible that, given efficient
translation from ATG2, the resulting modification of the signal
peptide may affect the secretion and/or targeting of human p35. It
has been suggested that this 34-aa sequence may be important for
generating a membrane-bound form of human p35 (44), and indeed, human IL-12 has been shown to exist in a membrane-bound
form on the surface of macrophages (45). Taken together, the regulatory mechanisms involved in human p35 expression remain
poorly defined and demand further investigation.
Conventional methods of analyzing p35 expression levels (i.e.,
RT-PCR or Northern blot hybridization) cannot distinguish between the different isoforms of p35 and so do not accurately reflect
the amount of translatable p35 message. Our results undermine the
importance of analyzing p35 expression at the molecular level
when studying IL-12 gene expression. Further investigation into
the transcriptional and translational mechanisms of p35 gene regulation and the way in which these two processes interact will
enhance our understanding of IL-12 gene expression.
4077
4078
REGULATION OF IL-12 EXPRESSION BY TRANSLATIONAL CONTROL OF p35
35. Kelleher, P., and S. C. Knight. 1998. IL-12 increases CD80 expression and the
stimulatory capacity of bone marrow-derived dendritic cells. Int. Immunol. 10:
749.
36. Garnier, G., A. Circolo, and H. R. Colten. 1995. Translational regulation of murine complement factor B alternative transcripts by upstream AUG codons. J. Immunol. 154:3275.
37. Bamford, R. N., A. P. Battiata, J. D. Burton, H. Sharma, and T. A. Waldmann.
1996. Interleukin (IL) 15/IL-T production by the adult T-cell leukemia cell line
HuT-102 is associated with a human T-cell lymphotrophic virus type I R region/
IL-15 fusion message that lacks many upstream AUGs that normally attenuate
IL-15 translation. Proc. Natl. Acad. Sci. USA 93:2897.
38. Bost, K. L., and J. D. Clements. 1997. Intracellular Salmonella dublin induces
substantial secretion of the 40-kilodalton subunit of interleukin-12 (IL-12) but
minimal secretion of IL-12 as a 70-kilodalton protein in murine macrophages.
Infect. Immun. 65:3186.
39. Stalder, A. K., A. Pagenstecher, N. Chen Yu, C. Kincaid, C. Chiang,
M. V. Hobbs, F. E. Bloom, and I. L. Campbell. 1997. Lipopolysaccharide-induced IL-12 expression in the central nervous system and cultured astrocytes and
microglia. J. Immunol. 159:1344.
40. Galbiati, F., L. Rogge, J. C. Guery, S. Smiroldo, and L. Adorini. 1998. Regulation
of the IL-12 receptor b2 subunit by soluble antigen and IL-12 in vivo. Eur.
J. Immunol. 28:209.
41. Brunvand, M. W., A. Krumm, and M. Groudine. 1993. In vivo footprinting of the
human IL-2 gene reveals a nuclear factor bound to the transcription start site in
T cells. Nucleic Acids Res. 21:4824.
42. Agarwal, S., and R. Anjana. 1998. Long-range transcriptional regulation of cytokine gene expression. Curr. Opin. Immunol. 10:345.
43. Merberg, D. M., S. F. Wolf, and S. C. Clark. 1992. Sequence similarity between
NKSF and the IL-6/G-CSF family. Immunol. Today 13:77.
44. Wolf, S. F., P. A. Temple, M. Kobayashi, D. Young, M. Dicig, L. Lowe,
R. Dzialo, L. Fitz, C. Ferenz, R. M. Hewick, et al. 1991. Cloning of cDNA for
natural killer cell stimulatory factor, a heterodimeric cytokine with multiple biologic effects on T and natural killer cells. J. Immunol. 146:3074.
45. Fan, X., V. Sibalic, E. Niederer, and R. P. Wuthrich. 1996. The proinflammatory
cytokine interleukin-12 occurs as a cell membrane-bound form on macrophages.
Biochem. Biophys. Res. Commun. 225:1063.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017