Expression of a single gene produces both forms
of skeletal muscle cyclic nucleotide-gated channels
LORRAINE C. SANTY AND GUIDO GUIDOTTI
Department of Molecular and Cellular Biology, Harvard University,
Cambridge, Massachusetts 02138
insulin; sodium channel
CYCLIC NUCLEOTIDE-GATED (CNG) channels were first
identified in rod outer segments, where they are responsible for the dark current (9). It was subsequently
shown that similar channels are also present in olfactory receptor cilia (25). In both of these tissues, the
CNG channels are involved in generating an electrical
signal in response to sensory stimuli (18). Purification
of the CNG channel from rod outer segments was
followed by the cloning of the CNG channel gene (4, 19).
Homologous genes comprising a large family have been
cloned from olfactory receptors, retinal cones, and a
variety of nonsensory tissues (6, 7, 20). The CNG
channel family members contain a putative cyclic nucleotide binding domain in their COOH terminal end and
have homology to the voltage-gated cation channel
family (16, 19, 30).
Although the CNG channels in photoreceptor and
olfactory receptor cells have a clearly defined physiological role, the role of CNG channels expressed in most
nonsensory tissues is less clear. Because CNG channels
conduct Ca21, one possible function of these channels
may be to increase internal calcium levels in response
to second messengers (10, 18). For example, a CNG
channel may mediate sperm chemotaxis, which de-
E1140
pends upon activation of a membrane- bound guanylate
cyclase and entry of extracellular Ca21 (12). The gene
encoding the cone CNG channel is also expressed in the
testis, and sperm membranes have been shown to
contain this protein, suggesting that this channel may
connect guanosine 38,58-cyclic monophosphate (cGMP)
to Ca21 entry (10, 29). Many other nonsensory tissues
have been shown to express CNG channel genes.
However, investigation of physiological roles or expression of the proteins in most of these tissues has not been
undertaken (10).
A physiological role for CNG channels has been
studied in skeletal muscle. In this tissue, CNG channels seem to be responsible for insulin-activated sodium entry (22, 23). Release of insulin into the blood
promotes uptake of potassium into skeletal muscle and
adipocytes by increasing the activity of the a2 isoform of
the Na-K-ATPase (3, 21, 27). Uptake of potassium from
the blood into skeletal muscle reflects the ability of this
tissue to act as a potassium reservoir for the rest of the
body (2). To prevent depletion of internal sodium by the
activated Na-K-ATPase, insulin also increases sodium
entry into skeletal muscle (3, 15). This constant replenishment of internal sodium allows the increased Na-KATPase activity to be maintained for upwards of an
hour (3, 23, 27).
An insulin-sensitive cation channel has been identified in rat skeletal muscle by patch clamping (22). This
channel is activated by the combination of insulin and
GTP or by cGMP alone, suggesting that it is a member
of the CNG channel family. Similar to other members of
the CNG channel family, this channel is fairly nonselective for monovalent and divalent cations and displays a
flickering block by calcium (22, 30). An inhibitor of the
skeletal muscle CNG channel, µ-conotoxin GIIIB, can
block insulin-activated sodium entry into intact skeletal muscle (22, 23). Two forms of CNG channel activity
have been isolated from rabbit skeletal muscle using
8-bromoguanosine 38,58-cyclic monophosphate (8-BrcGMP) affinity chromatography and reconstituted into
liposomes (28). These CNG channel forms differ in their
activation by cyclic nucleotides. One form has a halfmaximal activation constant (K1/2 ) for cGMP of 5.79 3
1027 M and a Hill coefficient of 3.63, whereas the other
form has a lower affinity with a K1/2 of 1.93 3 1025 M
and a Hill coefficient of 1.16 (28). The two forms of CNG
channel may be the products of different CNG channel
genes, the consequence of differential splicing of a
single gene, or the result of modulation of a single
protein. In understanding insulin-activated sodium
entry via a CNG channel, it will be important to know
0193-1849/97 $5.00 Copyright r 1997 the American Physiological Society
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.6 on June 15, 2017
Santy, Lorraine C., and Guido Guidotti. Expression of
a single gene produces both forms of skeletal muscle cyclic
nucleotide-gated channels. Am. J. Physiol. 273 (Endocrinol.
Metab. 36): E1140–E1148, 1997.—Cyclic nucleotide-gated
cation channels in skeletal muscle are responsible for insulinactivated sodium entry into this tissue (J. E. M. McGeoch and
G. Guidotti. J. Biol. Chem. 267: 832–841, 1992). These
channels have previously been isolated from rabbit skeletal
muscle by 8-bromoguanosine 38,58-cyclic monophosphate (8BrcGMP) affinity chromatography, which separates them into
two populations differing in nucleotide affinity [L. C. Santy
and G. Guidotti. Am. J. Physiol. 271 (Endocrinol. Metab. 34):
E1051-E1060, 1996]. In this study, a polymerase chain reaction approach was used to identify skeletal muscle cyclic
nucleotide-gated channel cDNAs. Rabbit skeletal muscle
expresses the same cyclic nucleotide-gated channel as rabbit
aorta (M. Biel, W. Altenhofen, R. Hullin, J. Ludwig, M.
Freichel, V. Flockerzi, N. Dascal, U. B. Kaupp, and F. Hofmann. FEBS Lett. 329: 134–138, 1993). The entire cDNA for
this gene was cloned from rabbit skeletal muscle and an
antiserum to this protein produced. Expression of this cDNA
produces a 63-kDa protein with cyclic nucleotide-gated channel activity. A similarly sized immunoreactive protein is
present in sarcolemma. Purification of the expressed channels reveals that this single gene produces both native
skeletal muscle channel populations.
E1141
ONE CNG GENE PRODUCES TWO CHANNELS
MATERIALS AND METHODS
Materials. Restriction enzymes and other enzymes for
molecular biology were from New England Biolabs (Beverly,
MA). Glutathione-Sepharose, thrombin, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), µ-conotoxin GIIIB, and protease inhibitors were purchased from
Sigma (St. Louis, MO). All reagents for tissue culture were
purchased from GIBCO-BRL (Grand Island, NY). HEK 293T
cells, which stably express SV40 large T, were obtained from
the laboratory of Dr. Ernest Peralta (Harvard University,
Cambridge, MA). Lipids were purchased from Avanti Polar
Lipids (Alabaster, AL). Primers were ordered from Genemed
Biotechnologies (South San Francisco, CA).
RNA isolation and cDNA production. Total RNA was
isolated from rabbit tissues using acid guanidinium thiocyanate phenol extraction (26). mRNA was isolated from the
total RNA using the PolyATtract mRNA isolation system
(Promega, Madison, WI) or the polyA Spin mRNA isolation kit
(New England Biolabs) according to the manufacturer’s instructions. The mRNA was transcribed into first strand cDNA
using oligo(dT), random 9-mer primers, and Stratascript
Reverse Transcriptase (Stratagene, La Jolla, CA) according to
the manufacturer’s protocol.
PCR. Primers were designed to correspond to conserved
regions of the cyclic nucleotide binding domain of CNG
channels or to the published sequence of the rabbit aorta
CNG channel gene (1). All primers, except 955, contained
restriction enzyme sites at their 58-end (DCNGF1 and
DCNGF2: EcoR I; all other primers: BamH I). Primer se-
quences are given below. Degenerate positions are given in
parentheses and I stands for inosine.
DCNFG1: CGGAATTCTIGGIA(G/A)(GA)
GA(G/A)ATGTA(C/T)AT
DCNGF2: CGGAATTCTIGGICGIGA
(G/A)ATGTA(C/T)AT
DCNGR: CGGGATCCTTIGCIGTIC(T/G)
IC(T/G)(A/G)TTICC
DCNG51: CGGGATCCGNATGTT(C/T)GA(A/G)TT
(C/T)TT(C/T)(G/C)A
3128B: CGGGATCCGGCGAGATTAGCATCCTTAA
RACNG32: CGGGATCCTGCAGATAGAGTCCTTCAGA
RACNG599: CGGGATCCTGTTTCTGGAGGCCAGGAAT
5128: CGGGATCCTTAAGGATGCTAATCTCGCC
955: AGCAGGGGCTGCTAGTGA
PCR reactions used cDNA as template for amplification with
the above primers. Generally, 35 cycles of PCR were run for
each reaction. Reactions contained 2.5 units of AmpliTaq
(Perkin-Elmer, Foster City, CA) and 0.0025 units Pfu (Stratagene) polymerases. Reactions to identify the gene (Fig. 1A)
were annealed at 50°C and had 2 min of extension at 72°C.
Reactions to isolate the gene (Fig. 1C) were annealed at 57°C
and had 5 min extension at 72°C. Aliquots of this primary
amplification were used as template and reamplified using
the same primers and conditions to obtain enough DNA for
cloning. PCR reactions to determine tissue expression (Fig. 2)
had an annealing temperature of 55°C and 2 min extension at
72°C. Reaction products were purified with the QIAquick
PCR purification kit (Qiagen, Chatsworth, CA). Reaction
products were then digested with the restriction enzymes
whose sites were present at the 58-end of the primers,
separated by agarose gel electrophoresis, isolated with the
Geneclean or MERmaid DNA isolation kits (Bio101), and
ligated into pGEM3zf2 (Promega).
DNA sequencing analysis and alignment. PCR products
were sequenced after cloning into pGEM. Sequencing was
carried out using T7 and SP6 primers and the Sequenase
DNA sequencing kit (United States Biochemical, Cleveland,
OH). DNA analysis and alignment was done using the
Genetics Computer Group sequence analysis software package (Genetics Computer Group, Madison, WI).
Glutathione S-transferase fusion protein production, purification, and antibody production. The 38-end of the rabbit
skeletal muscle CNG channel gene was amplified by PCR
using primers 3128B and RACNG32 with an annealing
temperature of 55°C and 2 min of extension at 72°C as
described above. A portion of this DNA from base 1914
(published aorta sequence numbering) to the EcoR I site at
base 2439 was excised from pGEM and was cloned in frame
into the vector pGEX-2T (Pharmacia, Piscataway, NJ). This
encoded a fusion of glutathione S-transferase (GST) and the
COOH-terminal 145 amino acids of the rabbit aorta/muscle
channel. This construct was expressed in Escherichia coli
BL21. The bacteria were lysed, and the fusion protein was
purified on glutathione-Sepharose using the procedure of
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.6 on June 15, 2017
which of these possibilities is responsible for the two
forms present in skeletal muscle.
In this study, polymerase chain reaction (PCR) has
been used to identify and clone the rabbit skeletal
muscle CNG channel cDNA. This cDNA is identical to
one previously cloned from rabbit aorta (1). An antiserum, anti-rabbit-cyclic-nucleotide-gated channel 3–1
(arCNG3–1), was raised against the COOH-terminal
145 amino acids of the rabbit skeletal muscle CNG
protein. Expression of this gene in tissue culture cells
leads to the production of a 63-kDa protein that reacts
with the arCNG3–1 antiserum. A protein of the same
size present in rabbit skeletal muscle sarcolemma also
reacts with this antiserum. Expression of the skeletal
muscle CNG channel cDNA in tissue culture cells
produces CNG channel activity that is most similar to
the low cGMP affinity form of the native skeletal
muscle channel. This CNG channel activity is inhibited
by µ-conotoxin GIIIB, which has previously been shown
to inhibit the native skeletal muscle CNG channel and
to inhibit insulin-activated sodium entry into this
tissue (22). Isolation of the expressed CNG channels
with 8-BrcGMP affinity chromatography reveals two
forms of CNG channels that resemble the native skeletal muscle channels. This result suggests that the
single CNG channel gene cloned from skeletal muscle is
responsible for both forms of channel observed in this
tissue and that the two forms may arise by differential
modulation of a single CNG channel protein.
E1142
ONE CNG GENE PRODUCES TWO CHANNELS
Frangioni and Neel (11). The CNG channel peptide was
eluted from the resin with glutathione or by thrombin digestion (8 U/1 ml resin). The purified, thrombin-eluted peptide
was then used for commercial production of polyclonal antiserum arCNG3–1 in guinea pigs (Cocalico Biologicals, Reamstown, PA).
Assembly of the entire gene and expression vector production. Partial digestion with EcoR I and digestion with BamH I
were used to isolate complementary and nonoverlapping 58
and 38 pieces of the CNG gene from the cloned skeletal muscle
PCR products. The complete coding sequence of the skeletal
muscle CNG channel was assembled in the BamH I site of
pGEM by joining these fragments at the EcoR I site at
position 1506 (aorta sequence numbering). The sequence of
the assembled coding region was determined by sequencing
small restriction fragments of this gene.
The vector pcDNA-rCNG, which uses a cytomegalovirus
promoter to drive high-level transcription in mammalian
cells, was produced by inserting the skeletal muscle CNG
coding sequence into pcDNA3 (Invitrogen, San Diego, CA).
Digestion of the assembled muscle CNG gene with Eco47 III
and BamH I was used to isolate the region from bases 138 to
2669. This fragment was ligated into pcDNA3, which had
been digested with Kpn I, blunted, and then digested with
BamH I.
Cell culture and transfection. HEK 293T cells were grown
in a humidified incubator with 5% CO2 at 37°C in Dulbecco’s
modified Eagle’s medium supplemented with penicillin, streptomycin, glutamine, and 10% fetal bovine serum. DNA for
transfection was isolated with the Qiagen plasmid MAXI kit
(Qiagen). Transfections were performed with the Lipofectamine reagent (GIBCO-BRL) according to manufacture’s
instructions. Cells were harvested 2–3 days posttransfection.
Membrane isolation. Crude membranes were isolated
from HEK 293T cells using the procedure of Coppi and
Guidotti (5). N-2-hydroxyethylpiperazine-N8-2-ethanesulfonic acid (HEPES)-buffered saline [10 mM HEPES-tris(hydroxymethyl)aminomethane (Tris), pH 7.4, 140 mM NaCl,
and 5 mM KCl] was used in the place of phosphate-buffered
saline. The crude membranes were resuspended in hypotonic
lysis buffer containing 10 mM HEPES-Tris, pH 7.4, 50 mM
sucrose, 2.5 µg/ml aprotinin, and 1.0 µg/ml each of pepstatin
A, chymostatin, and leupeptin. For isolation of enriched
plasma membranes, this membrane suspension was loaded
onto a sucrose step gradient containing two steps of 15 and
30% sucrose in 10 mM HEPES-Tris, pH 7.4. The gradient was
centrifuged at 200,000 g at 4°C for 2 h. Enriched plasma
membranes were isolated from the 15:30% sucrose interface.
Membranes were diluted with lysis buffer and were pelleted
by centrifugation at 100,000 g at 4°C for 30 min. The
membrane pellets were subsequently resuspended in lysis
buffer by homogenization, frozen in a dry ice-acetone bath,
and stored at 270°C.
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.6 on June 15, 2017
Fig. 1. Polymerase chain reaction
(PCR) identification and cloning of the
rabbit skeletal muscle cyclic nucleotidegated (CNG) channel gene. A: PCR
amplification of skeletal muscle CNG
gene, using mRNA (0.35 µg) or cDNA
(made from 0.25 µg mRNA) as template
with degenerate primers DCNGF1,
DCNGF2, and DCNGR. These primers
correspond to the amino acid sequences
(I/V)G(R/K)EMYI and GNRRTAN,
which are conserved in the cyclic nucleotide binding domains of all known
CNG channels. B: sequence alignment
of the skeletal muscle CNG gene. Skeletal muscle PCR product was cloned
and sequenced. Analysis of the sequence revealed that it was identical to
the previously cloned rabbit aorta CNG
channel gene (1). C: cloning of the entire skeletal muscle CNG channel gene
by PCR from rabbit skeletal muscle
cDNA with primers based on the published sequence of the rabbit aorta CNG
channel. Lane 1: 38-end of the CNG
channel gene amplified with primers
DCNG51 and RACNG32 (aorta sequence bases 1120 to 2669). Lane 2:
58-end of the gene amplified with primers RACNG599 and 5128 (bases 99 to
1933).
E1143
ONE CNG GENE PRODUCES TWO CHANNELS
channel activity by µ-conotoxin GIIIB was tested by obtaining
patches and assaying for CNG channel activity with the toxin
already present in the pipette. This technique was used
because, unlike sarcolemma, patches of transfected HEK
membranes were not stable enough to survive addition of the
toxin to the pipette after patch formation and demonstration
of CNG channel activity.
Patch-clamp data were collected and analyzed with the
program IGOR (Wavemetrics, Lake Oswego, OR) as described
previously (28). Titrations were normalized to the plateau
open current after subtraction of any background current.
Titrations were then fit by least squares to the Hill equation
I 5 Imax
[cGMP]n
n
K1/2
1 [cGMP]n
RESULTS
Fig. 2. Tissue expression of skeletal muscle CNG channel gene.
Rabbit mRNA (5 µg) from the indicated tissues was transcribed into
cDNA, and one-fifth of the cDNA was used as template for PCR with
primers 955 and 5128 (bases 955 to 1933, sequences described in
MATERIALS AND METHODS). Positive control contains the cloned skeletal
muscle CNG channel gene as template, whereas negative control
contains no template.
Sarcolemma was isolated as described previously (28).
These membranes were washed by diluting the membranes
two times in 1 M KCl and 10 mM ethylene glycol-bis(baminoethyl ether)-N,N,N8,N8-tetraacetic acid (EGTA), pH
7.4, and pelleting the membranes at 100,000 g for 30 min at
4°C. The membrane pellet was resuspended in lysis buffer by
homogenization. Protein concentration was determined on
membranes solubilized in 1% sodium dodecyl sulfate (SDS)
with the Bio-Rad DC protein reagent (Bio-Rad, Hercules,
CA).
SDS-polyacrylamide gel electrophoresis and immunoblotting. Membranes were solubilized in reducing sample buffer
(2% SDS, 65 mM Tris, pH 6.8, 5% b-mercaptoethanol) and
were separated by SDS-polyacrylamide gel electrophoresis
(PAGE). Column fractions were extracted with ether to
remove lipid and were precipitated with 6% trichloroacetic
acid. The pellets were washed with acetone and were resuspended in sample buffer before SDS-PAGE. Proteins were
transferred to nitrocellulose and were probed with arCNG3–
1 antiserum. Blots were probed with rabbit anti-guinea pig
immunoglobulin G-horseradish peroxidase (HRP) antiserum
(Sigma) or with protein A-HRP (Calbiochem, La Jolla, CA)
and were developed with the SuperSignal chemiluminescent
substrate for Western Blotting (Pierce, Rockford, IL) according to the manufacturer’s instructions.
8-BrcGMP affinity chromatography and patch clamping.
Membranes prepared from HEK cells were solubilized with
CHAPS, purified by 8-BrcGMP affinity chromatography, reconstituted, and prepared for patch clamping as described previously (28) with the following exceptions. When preparing
patch-clamp samples from unsolubilized HEK membranes,
only 0.1 µg of protein were used per 100 µg of lipid. Patch
clamping was performed in the absence of EGTA because its
presence tended to destabilize the patches. Inhibition of CNG
Cloning of the rabbit skeletal muscle CNG channel
coding sequence. To identify CNG channel genes expressed in rabbit skeletal muscle, we used a PCR
approach. The amino acid sequence of the cyclic nucleotide binding domain of known CNG channel genes was
aligned, and two well-conserved stretches of this region
were identified. Degenerate oligonucleotide primers
were designed to correspond to the consensus sequence
for these regions. As can be seen in Fig. 1A, these
primers amplify a band of the expected size [174 base
pairs (bp)] from rabbit skeletal muscle cDNA but not
from rabbit skeletal muscle mRNA. This result indicates that a member of the CNG channel family is
expressed in rabbit skeletal muscle. The band amplified from rabbit muscle cDNA was cloned and sequenced several times and was shown to be identical to
the CNG gene previously cloned from rabbit aorta (Fig.
1B; see Ref. 1). The published sequence of this aorta
gene (1) was therefore used to design primers to clone
the entire coding region from skeletal muscle by PCR.
All nucleotide and amino acid numbering used in this
study is that of the published aorta sequence (1). As
shown in Fig. 1C, both the 58 (bases 99 to 1933)- and 38
(bases 1120 to 2669)-ends of the aorta CNG channel
gene can be amplified by PCR from skeletal muscle
cDNA. These two pieces cover the entire coding region
of this gene (bases 153 to 2348) and have an 800-bp
overlap. An EcoR I site (position 1506) in this overlapping region was used to join the 58- and 38-ends and to
produce the entire skeletal muscle CNG channel gene
(aorta bases 99 to 2669). The entire skeletal muscle
gene was sequenced and is identical to the aorta
sequence except for two C to T transitions at positions
389 and 623. These changes do not change the amino
acid sequence and probably represent allelic variation
(data not shown).
PCR was also used to investigate the tissue distribution of expression of the skeletal muscle gene. As shown
in Fig. 2, a portion of this gene can be amplified from
skeletal muscle and stomach cDNA. Amplification from
stomach may indicate that this gene is expressed in
smooth as well as skeletal muscle. There may also be a
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.6 on June 15, 2017
where I is current, Imax is maximum current, [cGMP] is cGMP
concentration, and n is the Hill coefficient.
E1144
ONE CNG GENE PRODUCES TWO CHANNELS
low level of expression in kidney and brain where faint
bands can be seen in Fig. 2. Small amounts of additional bands were amplified from most tissues tested,
probably due to nonspecific priming.
Expression of skeletal muscle CNG channel gene. The
COOH-terminal 145 amino acids of the skeletal muscle
CNG channel were expressed as a GST fusion and
purified as described in MATERIALS AND METHODS (data
not shown). This purified peptide was used for production of guinea pig antiserum arCNG3–1 (produced by
Cocalico Biologicals). As can be seen in Fig. 3A, the
preimmune serum does not react with any proteins in
the bacteria expressing the fusion protein, whereas the
immune serum reacts strongly with the GST-CNG
fusion. Only one additional band is visible in the
bacterial lysate.
The entire skeletal muscle CNG channel was expressed in tissue culture cells by transient transfection.
As can be seen in Fig. 3B, expression of the skeletal
muscle CNG channel gene leads to production of a
63-kDa protein that reacts with the arCNG3–1 antise-
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.6 on June 15, 2017
Fig. 3. Immunoblotting with arCNG3–1 antiserum against the
rabbit skeletal muscle CNG channel COOH-terminus. A: characterization of arCNG3–1 antiserum. Proteins were separated with 7.5%
SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to
nitrocellulose. Blot was probed with a 1:1,000 dilution of preimmune
serum and then washed and reprobed with a 1:5,000 dilution of
immune serum. Lane 1: bacterial lysate expressing glutathione
S-transferase (GST)-CNG fusion protein; lane 2: purified GST-CNG
fusion protein. B: expression of the muscle CNG channel protein.
Plasma membranes were separated by 8% SDS-PAGE and were
probed with a 1:1,000 dilution of arCNG3–1. Lane 1: untransfected
HEK 293T cells (10 µg); lane 2: HEK 293T transfected with pcDNArCNG (10 µg); lane 3: rabbit sarcolemma (500 µg). C: sarcolemma
(375 µg) was blotted as in B and was probed with preimmune serum.
rum. Rabbit sarcolemma also contains an immunoreactive protein of the same size, confirming that this
protein is expressed in rabbit skeletal muscle (Fig. 3B,
lane 3). This band is not seen when rabbit sarcolemma
is probed with preimmune serum (Fig. 3C). The dark
band in sarcolemma at 42 kDa is the same size as actin
and probably represents a nonspecific reaction with
this abundant muscle protein.
The properties of the muscle CNG channel were
analyzed in HEK 293 cells because these cells have
previously been shown not to express any endogenous
CNG channel genes (7). As shown in Fig. 4, untransfected HEK cells do not show any increased current
with the addition of cGMP. In contrast, membranes
from cells transfected with the muscle CNG channel
gene do show an increase in current in response to the
addition of increasing amounts of cGMP, demonstrating that the product of the skeletal muscle CNG gene
does have CNG channel activity. Average currents of
representative patches containing untransfected or
transfected membranes are shown in Fig. 4A. Figure 4,
B and C, shows individual trials of experiments with
transfected and untransfected membranes. When these
transfected membranes are patched in the presence of
µ-conotoxin GIIIB, an inhibitor of the native skeletal
muscle CNG channel, this CNG activity is inhibited
(Fig. 4A). Fitting of the cyclic nucleotide dependence of
the expressed channel with the Hill equation produces
a fit with K1/2 for cGMP of 6.15 6 1.19 3 1025 M and a
Hill coefficient of 1.57 6 0.53 (Fig. 5). These characteristics are most similar to the low cGMP affinity form of
CNG channel seen in rabbit skeletal muscle (28).
Isolation of CNG channels with 8-BrcGMP affinity
chromatography. Titrations of HEK membranes expressing the muscle CNG channel gene seem to indicate that all CNG channel activity in these cells is the
low cGMP affinity channel form present in skeletal
muscle. However, the two forms of skeletal muscle CNG
channels only become apparent after solubilization and
purification by 8-BrcGMP affinity chromatography (28).
Therefore, we used isolation with 8-BrcGMP affinity
chromatography to investigate if both channel forms
seen in skeletal muscle are present in the transfected
HEK cells. As shown in Table 1, when transfected HEK
membranes are subjected to 8-BrcGMP affinity chromatography, CNG channel activity elutes from the column
in two populations that peak in fraction E2 and in
fraction E6 (Table 1). This elution profile is strikingly
similar to the pattern seen when rabbit sarcolemma is
purified by this method, where CNG channel activity
also elutes from the column in fractions E2 and E6 (28).
To further compare the two forms of CNG channel
isolated from transfected HEK cells with those present
in skeletal muscle, we investigated their cGMP dependence. Titration of the peak fractions of CNG channel
activity reveals that the HEK fraction E2 has a K1/2 for
cGMP of 4.59 6 0.95 3 1025 M and a Hill coefficient of
1.37 6 0.37, whereas HEK fraction E6 has a K1/2 of
5.27 6 0.66 3 1027 M and a Hill coefficient of 2.91 6
0.94 (Fig. 6). These values are very similar to those seen
in isolated skeletal muscle CNG channel populations
ONE CNG GENE PRODUCES TWO CHANNELS
E1145
(fraction E2: K1/2 of 1.93 3 1025 M and a Hill coefficient of
1.16; fraction E6: K1/2 of 5.79 3 1027 M and a Hill coefficient of 3.63; see Ref. 28). This suggests that the single
CNG channel gene cloned from skeletal muscle can produce both of the channel forms that are present in
skeletal muscle.
Proteins from the 8-BrcGMP column fractions described in Table 1 were precipitated, separated by
SDS-PAGE, and immunoblotted to confirm that the
expressed channel protein is present in both isolated
CNG channel populations. The CNG channel band in
the column fractions is diffuse and streaked (Fig. 7).
The rod CNG channel behaves in a similar manner
after purification by 8-BrcGMP affinity chromatography (28). As can be seen in Fig. 7, the skeletal muscle
CNG channel protein also seems to elute from the
8-BrcGMP column in two populations. The first population is in fractions E1 to E3, whereas the second
population is in fractions E5 and E6. This distribution
corresponds well to the distribution of the channel
activity. The lower band visible in the immunoblot was
present in all lanes of this blot, including the lane
containing untransfected HEK 293T membranes (Fig.
7). These cells are known not to express any endogenous CNG channel genes (7). Therefore, this lower
band is a background band that is unrelated to the
skeletal muscle CNG channel.
DISCUSSION
A gene for a CNG channel, which is identical to that
previously cloned from rabbit aorta (1), has been cloned
from rabbit skeletal muscle. The only sequence differences between the genes are two single base pair
changes that do not change the amino acid sequence of
the protein. However, there are differences between the
characteristics of the two expressed proteins. The product of the skeletal muscle gene in HEK 293T cells
shows a K1/2 for cGMP of 6.15 6 1.19 3 1025 M and a
Hill coefficient of 1.57 6 0.53, whereas the product of
the aorta gene in oocytes has been reported to have a
K1/2 of 1.7 µM and a Hill coefficient of 2.2 (1). This
discrepancy may be due to the different expression
systems and patch-clamp techniques used to study
these genes. The aorta CNG channel was studied using
injection of RNA into Xenopus oocytes and inside-out
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.6 on June 15, 2017
Fig. 4. Expressed skeletal muscle protein has CNG
channel activity. Plasma membranes from transfected
and untransfected HEK cells were used for tip-dip
patch clamping. Patches with gigaohm seals were picked
up on the end of a patch pipette, and current through
the patches was tested in the presence of increasing
amounts of cGMP in the bath solution. Current through
the patches was measured at voltages from 280 to 180
mV in 20-mV increments. Samples with toxin had 2 µM
µ-conotoxin GIIIB present in the bath and pipette
throughout the experiment. A: average current at 180
mV through representative patches. Data are means 1
SE of at least 6 trials at each cGMP concentration.
Summary of the number of patches with CNG channel
activity is shown at bottom. µ-Conotoxin data are from
the only patch to show cGMP-dependent current in the
presence of toxin. B: individual trials of untransfected
plasma membranes. Current traces were recorded in
response to voltage pulses ranging from 280 to 180 mV
in 20-mV increments. C: individual trials of transfected
plasma membranes.
E1146
ONE CNG GENE PRODUCES TWO CHANNELS
patches excised from the oocytes. The skeletal muscle
channel was expressed by transient transfection into
HEK cells and was tested using tip-dip patch clamping
of HEK plasma membranes.
The rabbit aorta/skeletal muscle gene is most similar
to cloned olfactory CNG channel genes (1). The only
previous report of the cloning of a CNG channel from
skeletal muscle is from Feng et. al. (8), who reported
amplifying 200 bp of the rat rod CNG channel gene
from skeletal muscle. However, none of our PCR reactions on rabbit skeletal muscle cDNA, including those
Table 1. Elution of expressed CNG channel activity
from 8-BrcGMP affinity chromatography
Fraction
Patches With CNG Channel Activity
E1
E2
E3
E4
E5
E6
E7
1
2
1
1
3
4
2
Data shown are the numbers of patches that showed an increase in
current with the addition of 1 or 100 µM cGMP. Plasma membranes
(400 µg protein) from HEK cells transfected with the muscle cyclic
nucleotide-gated (CNG) channel gene were solubilized and separated
using a 0.5-ml 8-bromoguanosine 38,58-cyclic monophosphate (8BrcGMP) affinity column. Briefly, proteins were bound, extensively
washed, and eluted with 1 mM 8-BrcGMP as previously described
(28). Each fraction listed above represents elution with 1 column
volume of 8-BrcGMP solution. Eluted proteins were then reconstituted into liposomes. Four separate samples of each fraction were
tested for CNG channel activity with tip-dip patch clamping, as
described in Fig. 4.
Fig. 6. cGMP titrations of isolated channel populations. Proteins
from fractions E2 and E6 of the 8-bromoguanosine 38,58-cyclic
monophosphate (8-BrcGMP) column were reconstituted into liposomes and patched by tip-dip patch clamping. Titrations were
performed as in Fig. 5. Fit for fraction E2 has K1/2 of 4.59 6 0.95 3
1025 M and a Hill coefficient of 1.37 6 0.37. Fit for fraction E6 has K1/2
of 5.27 6 0.66 3 1027 M and a Hill coefficient of 2.91 6 0.94.
using degenerate primers that would amplify any
known CNG channel gene, showed any evidence for the
expression of a rod channel in rabbit skeletal muscle.
The primers used by Feng et. al. (8) were specific for the
rod CNG channel and therefore would not have detected the expression of an olfactory CNG channel gene
in rat muscle. It has also previously been shown that
the same nonsensory tissue can express different CNG
channel genes, depending on the species (7).
Because the aorta/skeletal muscle CNG channel gene
has an open reading frame that encodes 732 amino
acids, the expected product is a protein of ,81 kDa.
However, the protein detected in transfected tissue
culture cells and native skeletal muscle appears by
SDS-PAGE to have a mass of 63 kDa. The native rod
a-subunit also has an apparent mass of 63 kDa on
SDS-PAGE, although its gene encodes a protein with a
theoretical molecular weight of 79,000 (4, 19). This
discrepancy has been attributed to the proteolytic
removal of the NH2-terminal 92 amino acids, producing
a protein with a theoretical molecular weight of 69,000
(24). A similar cleavage might reduce the size of the
skeletal muscle CNG protein. Alternatively, the size
difference may be due to the use of a different ATG to
initiate translation. The aorta CNG channel start site
of translation was assigned to the first in frame ATG,
which occurs after a stop codon, at position 153 (1).
However, because this codon is not in a perfect consensus sequence for initiation of translation, it has been
suggested that the actual start site might be the third
ATG, at position 357 (1). The codon at position 357 is in
a better consensus sequence and is homologous to the
ATG used to initiate translation of the olfactory CNG
channel (1). If translation does initiate at position 357
then the theoretical molecular weight of the aorta/
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.6 on June 15, 2017
Fig. 5. Titration of expressed muscle CNG channel. Plasma membranes of transfected HEK cells were tested by tip-dip patch clamping. Increasing amounts of cGMP were added to the bath, and
currents were recorded in response to voltage pulses at 160 and 180
mV. Data are average currents at 180 mV of individual titration
experiments normalized to the plateau open current. Each point is
mean 6 SE of the average current recorded during 5 test voltage
pulses. Data from all titration experiments were fit by least squares
to the Hill equation. Fit is shown and has a half-maximal activation
constant (K1/2 ) for cGMP of 6.15 6 1.19 3 1025 M and a Hill coefficient
of 1.57 6 0.53. Imax, maximum current; [cGMP], cGMP concentration.
ONE CNG GENE PRODUCES TWO CHANNELS
E1147
skeletal muscle CNG protein would be 73,000, much
closer to the observed size of the protein. Any remaining discrepancies in size might be due solely to the
difficulty in determining the size of membrane glycoproteins by SDS-PAGE.
Expression of the skeletal muscle CNG channel gene
in HEK cells followed by purification with 8-BrcGMP
affinity chromatography produces two populations of
CNG channel activity that are very similar to the two
forms seen after purification of native skeletal muscle
CNG channels. Both the native and expressed channels
elute from the column in two distinct populations, in
fractions E2 and E6. The cyclic nucleotide dependences
of the native and expressed populations are also strikingly similar. Fraction E2 from native skeletal muscle
has a K1/2 for cGMP of 1.93 3 1025 M, whereas that from
HEK plasma membrane has a K1/2 of 4.59 3 1025 M.
The native and expressed E6 populations are even
more similar with K1/2 values of 5.79 3 1027 M and
5.27 3 1027 M, respectively (for native values see Ref.
28). Because the expressed channel in HEK membranes appears to be primarily in the low-affinity state,
it might be expected that there would be more activity
in the E2 fraction than in the E6 fraction after affinity
chromatography. This doesn’t seem to be the case,
probably because the low-affinity form is less tightly
bound to the column. Immunoblotting reveals that the
expressed skeletal muscle CNG channel protein also
elutes from the column in two populations. These
results strongly suggest that the two CNG channel
forms present in skeletal muscle can be explained by
the expression of a single CNG channel gene, the aorta
gene.
The finding that expression of one CNG channel gene
can produce channels with widely varying cGMP affinities is not entirely unprecedented. It is well documented that the apparent affinity of the CNG channels
can be modulated over a wide range. For example,
phosphorylation of or nickel binding by the rod channel
can change its apparent cGMP affinity by an order of
magnitude (13, 14). Additionally, covalent cross-linking
of cGMP analogs to the native rod CNG channel has
demonstrated two populations of cGMP binding sites
with differing cGMP affinities. Cross-linking of cGMP
to the rod a-subunit expressed in Xenopus oocytes also
demonstrated that these channels can have two populations of cGMP binding sites (17). The affinities of the
two populations of cGMP binding sites seen by crosslinking, with K1/2 values of 0.42 and 16 µM, are similar
to those of isolated skeletal muscle channels (17, 28).
The greatest difference between the native and expressed skeletal muscle CNG channels is the cyclic
nucleotide dependence of the channels present in unsolubilized membranes. The CNG channels present in
unsolubilized skeletal muscle membranes are most
similar to the high cGMP affinity form that is seen after
8-BrcGMP affinity chromatography (28). The expressed
CNG channels in HEK plasma membranes, on the
other hand, are most similar to the low cGMP affinity
form. This finding supports the idea that the lowaffinity form of skeletal muscle CNG channel is not an
artifact of denaturation during solubilization. Isolation
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.6 on June 15, 2017
Fig. 7. Immunoblot analysis of 8-BrcGMP column fractions. Column fractions were precipitated with trichloroacetic acid and separated by SDS-PAGE as described
in MATERIALS AND METHODS. Blot was probed with
arCNG3–1 antiserum.
E1148
ONE CNG GENE PRODUCES TWO CHANNELS
We thank Dr. Maddalena Coppi for reading the manuscript and
providing insightful comments.
This work was supported by National Institutes of Health Grants
DK-27626 and GM-07598.
Address for reprint requests: L. C. Santy, Casanova Lab, Pediatric
Gastroenterology and Nutrition, Massachusetts General Hospital,
149 13th St., Charlestown, MA 02129.
Received 10 June 1997; accepted in final form 7 August 1997.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
REFERENCES
1. Biel, M., W. Altenhofen, R. Hullin, J. Ludwig, M. Freichel,
V. Flockerzi, N. Dascal, U. B. Kaupp, and F. Hofmann.
Primary structure and functional expression of a cyclic nucleotidegated channel from rabbit aorta. FEBS Lett. 329: 134–138, 1993.
2. Clausen, T. Regulation of active Na1-K1 transport in skeletal
muscle. Physiol. Rev. 66: 542–580, 1986.
3. Clausen, T., and P. G. Kohn. The effect of insulin on the
transport of sodium and potassium in rat soleus muscle. J.
Physiol. (Lond.) 265: 19–42, 1977.
4. Cook, N. J., W. Hanke, and U. B. Kaupp. Identification,
purification, and functional reconstitution of the cyclic GMPdependent channel from rod photoreceptors. Proc. Natl. Acad.
Sci. USA 84: 585–589, 1987.
5. Coppi, M. V., and G. Guidotti. Ubiquitination of Na,K-ATPase
a1 and a2 subunits. FEBS Lett. 405: 281–284, 1997.
6. Dhallan, R. S., K. W. Yau, K. A. Schrader, and R. R. Reed.
Primary structure and functional expression of a cyclic nucleotideactivated channel from olfactory neurons. Nature 347: 184–187,
1990.
7. Distler, M., M. Biel, V. Flockerzi, and F. Hofmann. Expression of cyclic nucleotide-gated cation channels in non-sensory
tissues and cells. Neuropharmacology 33: 1275–1282, 1994.
8. Feng, L., I. Subbaraya, N. Yamamoto, W. Baehr, and N.
Kraus-Friedmann. Expression of photoreceptor cyclic nucleo-
25.
26.
27.
28.
29.
30.
tide-gated cation channel alpha subunit (CNGC-alpha) in the
liver and skeletal muscle. FEBS Lett. 395: 77–81, 1996.
Fesenko, E. E., S. S. Kolesnikov, and A. L. Lyubarsky.
Induction by cyclic GMP of cationic conductance in plasma
membrane of retinal rod outer segment. Nature 313: 310–313,
1985.
Finn, J. T., M. E. Grunwald, and K. W. Yau. Cyclic nucleotidegated ion channels: an extended family with diverse functions.
Annu. Rev. Physiol. 58: 395–426, 1996.
Frangioni, J. V., and B. G. Neel. Solubilization and purification of enzymatically active glutathione-S-transferase (pGEX)
fusion proteins. Anal. Biochem. 210: 179–187, 1993.
Garbers, D. L. Molecular basis of fertilization. Annu. Rev.
Biochem. 58: 719–742, 1989.
Gordon, S. E., D. L. Brautigan, and A. L. Zimmerman.
Protein phosphatases modulate the apparent agonist affinity of
the light-regulated ion channel in retinal rods. Neuron 9: 739–
748, 1992.
Gordon, S. E., and W. N. Zagotta. A histidine residue associated with the gate of the cyclic nucleotide-activated channels in
rod photoreceptors. Neuron 14: 177–183, 1995.
Guidotti, G. Regulation of the (Na,K)-pump. Chemtracts Biochem. Mol. Biol. 1: 447–462, 1990.
Jan, L. Y., and Y. N. Jan. Tracing the roots of ion channels. Cell
69: 715–718, 1992.
Karpen, J. W., and R. L. Brown. Covalent activation of retinal
rod cGMP-gated channels reveals a functional heterogeneity in
the ligand binding sites. J. Gen. Physiol. 107: 169–181, 1996.
Kaupp, U. B. Family of cyclic nucleotide gated ion channels.
Curr. Opin. Neurobiol. 5: 434–42, 1995.
Kaupp, U. B., T. Niidome, T. Tanabe, S. Terada, W. Bonigk,
W. Stuhmer, N. J. Cook, K. Kangawa, H. Matsuo, T. Hirose,
T. Miyata, and S. Numa. Primary structure and functional
expression from complementary DNA of the rod photoreceptor
cyclic GMP-gated channel. Nature 342: 762–766, 1989.
Ludwig, J., T. Margalit, E. Eismann, D. Lancet, and U. B.
Kaupp. Primary structure of cAMP-gated channel from bovine
olfactory epithelium. FEBS Lett. 270: 24–29, 1990.
Lytton, J., J. C. Lin, and G. Guidotti. Identification of two
molecular forms of (Na1,K1 )-ATPase in rat adipocytes. Relation
to insulin stimulation of the enzyme. J. Biol. Chem. 260: 1177–
1184, 1985.
McGeoch, J. E. M., and G. Guidotti. An insulin-stimulated
cation channel in skeletal muscle. Inhibition by calcium causes
oscillation. J. Biol. Chem. 267: 832–841, 1992.
McGeoch, J. E. M., and A. D. Morielli. An insulin-sensitive
cation channel controls [Na1]i via [Ca21]o-regulated Na1 and
Ca21 entry. Mol. Biol. Cell 5: 485–496, 1994.
Molday, R. S., L. L. Molday, A. Dose, I. Clark-Lewis, M.
Illing, N. J. Cook, E. Eismann, and U. B. Kaupp. The
cGMP-gated channel of the rod photoreceptor cell characterization and orientation of the amino terminus. J. Biol. Chem. 266:
21917–21922, 1991.
Nakamura, T., and G. H. Gold. A cyclic nucleotide-gated
conductance in olfactory receptor cilia. Nature 325: 442–444,
1987.
Puissant, C., and L.-M. Houdebine. An improvement of the
single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Biotechniques 8: 148–149,
1990.
Resh, M. D., R. A. Nemenoff, and G. Guidotti. Insulin
stimulation of (Na1,K1 )-adenosine triphosphatase-dependent
86Rb1 uptake in rat adipocytes. J. Biol. Chem. 255: 10938–
10945, 1980.
Santy, L. C., and G. Guidotti. Reconstitution and characterization of two forms of cyclic nucleotide-gated channels from skeletal muscle. Am. J. Physiol. 271 (Endocrinol. Metab. 34): E1051–
E1060, 1996.
Weyand, I., M. Godde, S. Frings, J. Weiner, F. Muller, W.
Altenhofen, H. Hatt, and U. B. Kaupp. Cloning and functional
expression of a cyclic-nucleotide-gated channel from mammalian
sperm. Nature 368: 859–863, 1994.
Zagotta, W. N., and S. A. Siegelbaum. Structure and function
of cyclic nucleotide-gated channels. Annu. Rev. Neurosci. 19:
235–263, 1996.
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.6 on June 15, 2017
of the CNG channels by 8-BrcGMP affinity chromatography demonstrates that both high and low cGMP
affinity channels are present in HEK and skeletal
muscle membranes. Perhaps a ubiquitous modification
system modulates the affinity of the skeletal muscle
channel, and the levels of this modulation are controlled in a tissue-specific manner. Despite these differences, both the native skeletal muscle CNG channel,
which is responsible for insulin-activated sodium entry,
and the expressed CNG channel can be inhibited by
µ-conotoxin GIIIB.
The fact that expression of one CNG channel protein
can produce both forms of skeletal muscle CNG channels could have important implications for insulinactivated sodium entry. Insulin may increase sodium
entry by increasing cGMP levels and thereby opening
the CNG channels. Most of the native skeletal muscle
channels may be in the high-affinity form to make them
sensitive to small changes in a low level of cGMP.
Alternatively, insulin could act to increase the percentage of channels in the high-affinity form, which would
increase sodium entry at resting cGMP levels. No
matter what the action of insulin, the fact that a single
CNG channel protein can produce two CNG channel
forms with such disparate cGMP affinity confirms that
these channels are not the static sensors of cGMP
levels, as was thought when they were first discovered.
CNG channels can be modulated by many signals and
can produce channels with a large range of affinities.
This provides cells expressing these channels with
great flexibility in controlling cation entry and in
linking this entry to signaling systems.