This information is current as
of June 14, 2017.
Cutting Edge: DNA Immunization with
Minigenes of Carbohydrate Mimotopes
Induce Functional Anti-Carbohydrate
Antibody Response
Thomas Kieber-Emmons, Behjatolah Monzavi-Karbassi, Bin
Wang, Ping Luo and David B. Weiner
J Immunol 2000; 165:623-627; ;
doi: 10.4049/jimmunol.165.2.623
http://www.jimmunol.org/content/165/2/623
Subscription
Permissions
Email Alerts
This article cites 21 articles, 11 of which you can access for free at:
http://www.jimmunol.org/content/165/2/623.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2000 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
References
●
Cutting Edge: DNA Immunization with
Minigenes of Carbohydrate Mimotopes
Induce Functional Anti-Carbohydrate
Antibody Response1
Thomas Kieber-Emmons,2
Behjatolah Monzavi-Karbassi, Bin Wang, Ping Luo,
and David B. Weiner
T
argeting carbohydrate Ags associated with either pathogens or expressed on tumor cells is a challenge in the
design of effective vaccines. Carbohydrates are traditionally viewed as T cell-independent Ags with a number of unique
and important immunological properties that are not encountered
when inducing an immune response to protein (1). These properties have precluded the use of pure carbohydrate or polysaccharide
Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, PA 19104
Received for publication March 22, 2000. Accepted for publication May 15, 2000.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
(PS)3 vaccines in those patients most at risk. Conjugate vaccine
technology has overcome some of the limitations of carbohydrates
as vaccine Ags because of the T-dependent help conferred by the
protein (2). Nevertheless, PS conjugates induce responses that are
often deficient in many respects, including the lack of induction of
the Th1-associated murine IgG2a isotype (3), while inducing predominately IgG1 and IgG3 isotypes.
An alternative approach to develop T-dependent responses to
carbohydrate Ags is the use of peptide or polypeptide surrogates of
carbohydrates. Carbohydrate-mimicking peptides could significantly improve vaccines against infectious pathogens or tumor
cells (4). Peptides that mimic carbohydrate structure have significant advantages as vaccines compared with carbohydrate-protein
conjugates. Most notably, peptides can be engineered to induce
Th1 responses by their incorporation into DNA plasmids for vaccination. The induction of a Th1-like response is the predominant
response to DNA vaccines (5, 6). It is now accepted that Th1dominant immunity, which is regulated by IL-12 and IFN-␥, plays
a pivotal role in the eradication of tumors in vivo and in mediating
pathogen clearance. Therefore, immunization with peptide mimotope-encoding minigenes can provide a cellular-associated response to carbohydrate Ags not achievable by PS conjugates alone.
Redirection of the immune response to a Th1-like profile may
augment vaccine responsiveness to these otherwise challenging
Ags. Here, we report for the first time that peptide mimotopes
constructed into DNA plasmids can prime for the induction of a
carbohydrate Th1-associated IgG2a cross-reactive immune response. The feasibility of immunization with peptide-mimotope
DNA plasmids (minigene) was investigated in mice by studying
whether minigene vaccination can prime for the induction of Th1associated IgG2a Ab cross-reactive with the human tumor-associated Histo-Blood group-related neolactoseries Ag Lewis Y (LeY).
A Th1 response with the expression of the IgG2a isotype is a
desirable response as IgG2a Abs are opsonizing and complement
fixing.
Materials and Methods
Construction of the expression vectors
This work was supported by National Institutes of Health Grant R01AI45133 (to
T.K.E.). D.B.W. is supported by National Institutes of Health Grant SRO1
A135515-04A3.
Oligonucleotides were synthesized and inserted into pcDNA3 or pcDNA1
vectors. In the design of pcDNAggi and pcDNAari, we included a leader
2
Address correspondence and reprint request to Dr. Thomas Kieber-Emmons, Department of Pathology and Laboratory Medicine, Room 280, John Morgan Building,
36th and Hamilton Walk, Philadelphia, PA 19104-6082. E-mail address: tom@xray.med.upenn.edu
3
Abbreviations used in this paper: PS, polysaccharide; LeY, Lewis Y; CDC, complement-dependent cytotoxicity.
Copyright © 2000 by The American Association of Immunologists
●
0022-1767/00/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
To date, the generation of anti-carbohydrate Th1 immune responses, which would be useful for both tumor immunotherapy as well as in pathogen vaccine strategies, has been elusive.
To augment Th1 immune responses to carbohydrate Ags, we
describe results of DNA vaccination studies in mice using plasmids encoding designed peptide mimotopes (minigenes) of the
neolactoseries Ag Lewis Y (LeY). In contrast to LeY immunization, immunization with mimotope-encoded plasmids induced LeY cross-reactive IgG2a Abs. Minigene immunization
primed for a LeY-specific response that is rapidly activated
upon encounter with nominal Ag upon subsequent boost. The
resulting IgG2a response mediated complement-dependent cytotoxicity of a LeY-expressing human tumor cell line in the
presence of human complement. These studies establish that
peptide mimotopes of carbohydrate Ags encoded as DNA plasmids are novel immunogens providing a means to manipulate
carbohydrate cross-reactive Th1 responses. The Journal of
Immunology, 2000, 165: 623– 627.
624
CUTTING EDGE
Table I. Plasmids used in this study
Plasmid
Designation
pcDNAari
pcDNAggi
pVHSOL
a
Vector
pCDNA3
pCDNA3
pcDNA1
Leader Sequence
MRYMILGLLALAAVCSAA
MRYMILGLLALAAVCSAA
–
T Cell Sequencea
KQIINMWQEVGKAMYA(36)
KQIINMWQEVGKAMYA(34.5)
–
Peptide Sequencea
ARIYYRYDGFAY (60)
GGIYWRYDIYWRYDIY(2000)
ARIYYRYDGFAY(60)
Values in parenthesis are estimated half time of disassociation of a molecule containing this sequence using a subsequence of 9 or 10 for scoring (13).
DNA and carbohydrate immunizations
The quadriceps of muscles of mice were injected as described earlier (9).
Briefly, each BALB/c mouse (groups of four) received two i.m. injections
(3 wk apart) with 100 ␮g of each DNA construct resuspended in 100 ␮l of
PBS and 0.25% bupivacaine-HCl (Sigma, St. Louis, MO). For carbohydrate boost, mice were injected i.p. with 40 ␮g of LeY and incorporated
into polyacrylamide matrix (GlycoTech, Rockville, MD) along with 20 ␮g
QS-21 (Aquila Biopharmaceuticals, Farmingham MA).
ELISA
To assess LeY reactivity of collected serum, standard ELISA was performed as described previously (10). Wells were coated with 0.2 ␮g/well
of LeY. After blocking with 0.5% FCS in PBS, serum samples were added
to each well in triplicate. Goat anti-mouse IgG/or IgM conjugated with
HRP (Sigma) was used as secondary Ab. For isotype detection, we used
Immunopure mAb isotyping kit I (Pierce, Rockford, IL) based on the manufacturer instruction. To prepare a standard curve to quantify the amount of
IgG isotypes, plates were coated with mouse serum, and IgG reactivity was
assessed using different concentrations of isotype-specific Abs (10). In addition, we quantified the LeY activity of the serum as calculated from a
standard curve generated concurrently using the LeY-reactive IgG2a Ab
BR55-2 (10).
Cell-based assays
Splenocytes from experimental and control animals were used for detection
of T cell proliferation as described (9). Several peptides were used in these
assays that include peptide 106 with the sequence GGIYWRYDIYWRY
DIYWRYD. This peptide was synthesized as a multiple Ag peptide (Research Genetics, Huntsville, AL) as described previously (10). Briefly,
cells were incubated without or with peptides, and after 3 days of incubation 1 ␮Ci of [3H]thymidine was added to each well for another 16 –18 h.
Cells were harvested and counted on a Betaplate liquid scintillation counter
(Wallac, Gaithersburg, MD). Cytotoxic activity was measured by a standard 5-h 51Cr release assay (9). To calculate specific lysis of targets, the
percent lysis of nonspecific targets (p815 cells; American Type Culture
Collection, Manassas, VA) was subtracted from the percent lysis of specific targets (peptide-pulsed p815 cells). Peptide-pulsed targets were prepared by incubating p815 cells with 1 mM concentration of the 106 peptide
for 18 h at 37°C. CD8⫹ T cells were removed from the splenocytes by
treatment with anti-CD8 mAb (53-6.7) (PharMingen, San Diego, CA) followed by incubation with rabbit complement. Complement-dependent cytotoxicity (CDC) was measured using the LeY-expressing human tumor
cell line MCF7 (American Type Culture Collection) and human complement (Sigma) as previously described (10). The anti-LeY mAb BR55-2
was used as a positive control and for IgG standardization (10).
Statistical analysis
Data were expressed as arithmetic mean ⫾ SD and analyzed by the Statview 4.1 program (Abacus Concepts, Berkeley, CA). Data were analyzed
for normal distribution, and the statistical significance of the difference
between groups was determined by the two-tailed Student’s t test.
Results
Choice of peptides as DNA immunogens
Plasmids pcDNAari and pcDNAggi (Table I) were designed to
express chimeric peptides that include a secretory leader sequence,
a T cell epitope from HIV-1 gp120 (referred to as the T1 peptide;
Ref. 8), and respective carbohydrate mimotope-encoding sequences that mimic the meningococcal group C capsular PS of
Neisseria meningitidis (11), Lewis Ags expressed on tumor cells
(10) and mannosyl, lactoseries, and sialyl residues on HIV-1
gp120 (12). It was rationalized that the leader sequence would
allow exogenous expression with the inclusion of the T cell
epitope to augment T cell help. In plasmid pVHSOL, we cloned
only the peptide mimic sequence of pcDNAari without the leader
and T1 seqeunces.
The T1 epitope is suggested to bind to both MHC class II and
class I. MHC class I binding sequences can also be subsets of
MHC class II binding peptides. Representative HLA binding predictions identify an H2-K (BALB/c) class I binding motif centered
on two 9-mer sequences of the T1 peptide (Table I) (13). Likewise,
the mimotope sequences encoded in pcDNAari and pcDNAggi
contain 10-mer sequences predicted as class I binding peptides
(Table I).
DNA vaccination results in LeY cross-reactive immune response
Separate groups of animals were immunized with the respective
constructs and 3 wk after the immunization, serum reactivity with
LeY was quantified by ELISA. Results with 10-fold diluted serum
showed a statistically significant increase in the reactivity of IgG
Ab after immunization with these constructs. No IgM was detected. Mice were again immunized at week 3, and the titration of
anti-LeY immune response at week 5 was determined (Table II).
The LeY cross-reactivity was persistent to a 1:256 dilution for
serum from pcDNAggi-immunized animals, which is statistically
significant ( p ⬍ 0.05) compared with serum from control vectorimmunized mice. Immunization with pcDNAggi induced a consistently growing LeY cross-reactive response that appears superior to the other two plasmids. The mimotope in pcDNAggi reflects
a repetitive Ag, which is typically more immunogenic (14) or the
peptide represents a better mimic of the LeY epitope. Isotyping
and quantitation of serum Abs of pcDNAggi-immunized mice for
subsequent weeks indicate a LeY cross-reactive IgG2a-dominant
response compared with IgG1 and IgG2b, which is indicative of a
Th1 immune response (Fig. 1). At week 7, IgG2a showed a 10-fold
increase compared with preimmune serum with a concentration of
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
(7) and Th epitope (8) in the beginning of the peptide sequence. The plasmid pcDNAggi was generated by inserting the leader sequence oligonucleotide AGCTTCCACCATGAGGTACATGATTTTAGGCTTGCTCG
CCCTTGCGGCAGTCTGCAGCGC between the restriction sites HindIII
and NotI in the polylinker region. The T1 and peptide mimotope-encoded
oligonucleotide GGCCGCGAAGCAGATCATCAACATGTGGCAGGA
GGTGGGCAAGGCCATGTACGCCGGCGGCATCTACTGGCGCTAC
GACATCTACTGGCGCTACGACATCTACTGGAGGTACGACTAAT
was further cloned into the NotI and XbaI sites. The later oligonucleotide
was replaced by GGCCGCGAAGCAGATCATCAACATGTGGCAGGA
GGTGGGCAAGGCCATGTACGCCCGCATCTACTACCGCTACGAC
GGCTTCGCCTACTAAT to generate the pcDNAari plasmid. All inserts
were sequenced after construction. Plasmids were grown in Escherichia
coli DH5␣ strain. DNA was purified using a maxi prep kit (Qiagen, Valencia, CA). Plasmid pVHSOL was generated in pcDNA1 (Invitrogen, San
Diego, CA) in the same way as pcDNAari but without the leader and the
Th epitope-encoding sequences. The gene expression of both vectors is
under the control of the CMV promoter. Expression is virtually the same
for the vectors according to the manufacturer. The cloning of IL-4 and Il-12
genes was previously described (9).
The Journal of Immunology
625
Table II. IgG titer in pooled sera of four mice in each experimental
groupa
Constructs
IgG Titer Before
Carbohydrate Boost
IgG Titer After Carbohydrate
Boost
pcDNAari
pcDNAggi
pVHSOL
64 ⫾ 7
256 ⫾ 23
64 ⫾ 9
200 ⫾ 24
800 ⫾ 72
200 ⫾ 18
a
The titers are shown as the highest sera dilution with significantly different OD
as compared with sera from vector-immunized mice using paired Student’s t test ( p ⬍
0.05). Blood was collected 2 wk after second DNA immunization (before carbohydrate boost) and 3 wk after carbohydrate boost.
0.12 ␮g/ml. However, IgG production dropped significantly after
week 7. These results are in agreement with other reports, where a
predominant IgG2a response is generated following i.m. DNA immunization. Again, no IgM was detected.
DNA priming and protein boosting can enhance the production
and functionality of induced Ab. Here, we tested this boost strategy with carbohydrate Ag. Minigene-primed mice and a vectorinjected control group were boosted with 40 ␮g of polyvalent synthetic LeY with QS-21 on week 8 and bled on week 9 and 11.
Minigene immunization induced the formation of LeY cross-reactive memory cells that were rapidly and specifically stimulated
upon encounter with LeY (Table II). Enhancement of IgG was
persistent with a statistically significant difference compared with
vector alone-primed/LeY-boosted mice. Anti-LeY reactivity of serum from pcDNAggi-primed/LeY-boosted mice increased more
than three times in titer from 1 to 256 (before boost) to 1 to 800
titer (after boost) (Table II). As expected, boosting with LeY led to
an enhanced anti-LeY IgM response (data not shown). IgM levels
increased a week after immunization and dropped 3 wk after the
immunization.
We also determined the isotype components at week 11 (Fig. 2).
IgG2a remained the predominant component of the immune response, with a 4-fold higher titer for pcDNAggi compared with the
two other minigenes (Table II), suggesting that the WRYDI-con-
taining peptide better mimics LeY. The IgG level slightly increased up to 5 wk after carbohydrate boost (not shown). These
data suggest mimotope-encoded DNA immunization generates a
memory B cell population that can be expanded by the nominal Ag
boost. In bacterial model systems, animals primed with carbohydrate-conjugated vaccines demonstrate a booster response after
secondary immunization with either carbohydrate or carbohydrateconjugate (15). It is suggested that the same general phenomenon
can be observed upon priming with mimotope-encoded DNA followed by carbohydrate boosting. Priming with mimotopes of
pathogen (or tumor)-associated carbohydrate Ags followed by
boosting with cognate or nominal carbohydrate Ag allows desired
memory cells to be established that could be effective to thwart
early infection or metastasis.
Induced IgG2a Ab mediates cell killing
The functional property of the induced serum from pcDNAggiimmunized mice was tested in CDC assays against the LeY-expressing human breast tumor cell line MCF7 in the presence of
human complement (Fig. 3A). The IgG2a anti-LeY mAb BR55-2
(10) served as a positive control (Fig. 3B) and to assess the relative
effective anti-LeY-reactive concentration of mimotope-induced
Ab. The lowest statistically significant titer before boosting that
mediated CDC ( p ⬍ 0.01) displayed an effective concentration of
mimotope-induced IgG2a of about 0.14 ␮g/ml compared with
BR55-2 (Fig. 3B). After boost, the percentage of cytotoxicity was
enhanced ( p ⬍ 0.001) to an effective concentration of about 0.22
␮g/ml compared with BR55-2 (Fig. 3B).
T cell responses
FIGURE 1. Serum response to minigene immunization. Serum from
pcDNAggi-immunized mice (four per group) from week 2 to week 7 after
first immunization were diluted 1:50, and quantitative LeY-reactive isotypes were assessed by anti-IgG1, IgG2a, and IgG2b Abs. The ratios were
calculated as the amount (␮g/ml) of LeY IgG isotypes in serum from
pcDNAggi-immunized animals in a given week divided by that amount in
preimmune serum. Error bars are calculated based on independent
experiments.
CTL recognize target proteins as short peptides presented by MHC
class I restriction elements. However, there is also evidence for
peptide-independent TCR recognition of target proteins and nonprotein structures. How such T cell responses are generated is presently unclear. Carbohydrate-reactive T cells have been described
(16 –18). T cells induced by a carbohydrate mimic has been shown
to cross-react with a protein Ag expressed on tumor cells (19). It
maybe possible that peptide mimics can expand T cells that are
reactive with naturally processed glycopeptides. Consequently, we
asked if DNA immunization with peptide mimics could lead to T
cell responses as predicted by analysis of MHC class I and class II
binding profiles (Table I).
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
DNA vaccination primes for carbohydrate-inducible IgG Ab
response
FIGURE 2. Isotype components as relative ratio of IgG2a to IgG1 and
IgG2b after boost. The amount of IgG isotypes was quantified based on the
mean level of serum (n ⫽ 4). IgG2a was divided by the mean (IgG1 ⫹
IgG2b) level in each immunization group. Blood was collected 3 wk after
carbohydrate boost and diluted to 1:50. The naive group was also immunized with carbohydrate.
626
CUTTING EDGE
FIGURE 4. . IL-12 coimmunization with pcDNAggi induces a significant CD8⫹-dependent CTL activity. Splenocytes were stimulated for 5
days. Cytotoxicity was measured on peptide-pulsed p815 cells as targets.
f, pcDNAggi ⫹ IL-12; Œ, pcDNAggi ⫹ IL-12 (CD8⫹ cells depleted); F,
pcDNAggi.
Acknowledgments
Several relevant peptides including peptide 106 were used to
stimulate T cells. We did not observe any significant differences
between immunized groups in T cell proliferation (data not
shown). To further determine whether augmentation of Th activity
would affect the magnitude of the immune response, we coimmunized additional groups of mice with the plasmids in Table I along
with plasmids encoding IL-12 and IL-4. Coimmunization with either cytokine-encoding plasmid did not influence any further the
Ab response to LeY relative to that previously shown with peptideencoded plasmid alone. However, we observed a significantly
higher T cell proliferation of splenocytes derived from mice immunized with the pcDNAggi plasmid with coimmunization with
IL-12 (data not shown). Detected IFN-␥ released (not shown) in
supernatant collected from in vitro peptide-activated splenocytes
again supported Th1-type activation consistent with the observed
IgG2a production. Expectedly, the Th1 response leads to a high
cytotoxic T lymphocyte activity against peptide-pulsed class I⫹
class II⫺ mastocytoma P815 target cells in coimmunized animals
(Fig. 4). As expected, the removal of CD8⫹ T cells resulted in the
suppression of specific lysis enhancement observed with coimmunization of IL-12 gene (Fig. 4). Parental P815 cells were not lysed.
We did not detect any enhancement in T cell proliferation, CTL, or
Ab response upon coimmunization with IL-4, exactly as previously reported (20).
We observe that DNA immunizations with plasmids encoding
peptide mimotopes of carbohydrate Ags induce carbohydrate
cross-reactive humoral responses, albeit of low titer. Packaging of
We thank Kaity Y. Lin, Shahram Shamloo, Matthew Kieber-Emmons, and
Habib Rahbar for technical assistance in DNA purification and ELISAs.
We thank Charlotte Read Kensil of Aquila Biopharmaceuticals for the
QS-21.
References
1. Mond, J. J., A. Lees, and C. M. Snapper. 1995. T cell-independent antigens type
2. Annu. Rev. Immunol. 13:655.
2. Ahmad, H., and E. K. Chapnick. 1999. Conjugated polysaccharide vaccines. Infect. Dis. Clin. North Am. 13:113.
3. Buchanan, R. M., B. P. Arulanandam, and D. W. Metzger. 1998. IL-12 enhances
antibody responses to T-independent polysaccharide vaccines in the absence of T
and NK cells. J. Immunol. 161:5525.
4. Shikhman, A. R., and M. W. Cunningham. 1997. Trick and treat: toward peptide
mimic vaccines. Nat. Biotechnol. 15:512.
5. Lai, W. C., and M. Bennett. 1998. DNA vaccines. Crit. Rev. Immunol. 18:449.
6. Cohen, A. D., J. D. Boyer, and D. B. Weiner. 1998. Modulating the immune
response to genetic immunization. FASEB J. 12:1611.
7. Persson, H. H., H. Jornvall, and J. Zabielski. 1980. Multiple mRNA species for
the precursor to an adenovirus-encoded glycoprotein: identification and structure
of the signal of the signal sequence. Proc. Natl. Acad. Sci. 77:6349.
8. Ahlers, J. D., T. Takeshita, D. Pendelton, and J. A. Berzofsky. 1997. Enhanced
immunogenecity of HIV-1 vaccine construct by modification of the native peptide sequence. Proc. Natl. Acad. Sci. USA 94:10856.
9. Kim, J. J., N. N. Trivedi, L. K. Nottingham, L. Morrison, A. Tsai, Y. Hu,
S. Mahalingam, K. Dang, L. Ahn, N. K. Doyle, et al. 1998. Modulation of amplitude and direction of in vivo immune response by co-adminstration of cytokine
gene expression cassettes with DNA immunogens. Eur. J. Immunol. 28:1089.
10. Kieber-Emmons, T., P. Luo, J.-P. Qiu, T. Y. Chang, I. O, M. Blaszczyk-Thurin,
and Z. Steplewski. 1999. Vaccination with carbohydrate peptide mimotopes promotes anti-tumor responses. Nat. Biotechnol. 17:660.
11. Westerink, M. A. J., P. C. Giardina, M. A. Apicella, and T. Kieber-Emmons.
1995. Peptide mimicry of the meningococcal group C capsular polysaccharide.
Proc. Natl. Acad. Sci. USA 92:4021.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
FIGURE 3. CDC assay with human MCF7 cells. A, This experiment
was performed using serum from immunized mice before and 2 wk after
carbohydrate boost. B, Titration of CDC-mediated killing of MCF7 cells
using anti-LeY (BR55-2) Ab. ⴱⴱⴱ, p ⬍ 0.001 and ⴱⴱ, p ⬍ 0.01 compared
with vector immunized animals using Student’s t test. ⴱ, p ⬍ 0.025
compared with pcDNAggi-immunized animals before boost using Student’s t test.
these epitopes into more effective T cell stimulators or presenting
them as multivalent Ags (21) along with adjuvants that further
potentiate Th1 response should improve the titers. IgG2a and IgG3
isotypes have been reported to be particularly effective in conferring protection against encapsulated organisms, and Th1 responses
are associated with more efficacious tumor vaccination. It is clearly
a unique property of this approach to induce a humoral carbohydrate cross-reactive, a Th, and a CTL response in one simple inoculation. It should be possible to further engineer peptides that
mimic glycopeptides that are processed on native Ags to further
augment T cell responses. It is also likely that engineering mimotopes into hybrid plasmids, which replace the model Th epitope
with Th or CTL epitopes from a pathogen or tumor target itself,
would be expected to build in a memory response that is relevant
in the context of challenge.
The Journal of Immunology
12. Agadjanyan, M., P. Luo, M. A. Westerink, L. A. Carey, W. Hutchins,
Z. Steplewski, D. B. Weiner, and T. Kieber- Emmons. 1997. Peptide mimicry of
carbohydrate epitopes on human immunodeficiency virus. Nat. Biotechnol. 15:
547.
13. Parker, K. C., M. A. Bednarek, and J. E. Coligan. 1994. Scheme for ranking
potential HLA-A2 binding peptides based on independent binding of individual
peptide side-chains. J. Immunol. 152:163.
14. Fehr, T., M. F. Bachmann, E. Bucher, U. Kalinke, F. E. Di Padova, A. B. Lang,
H. Hengartner, and R. M. Zinkernagel. 1997. Role of repetitive antigen patterns
for induction of antibodies against antibodies. J. Exp. Med. 185:1785.
15. Rubinstein, L. J., P. A. Garcia-Ojeda, F. Michon, H. J. Jennings, and K. E. Stein.
1998. Murine immune responses to Neisseria meningitidis group C capsular polysaccharide and a thymus-dependent toxoid conjugate vaccine. Infect. Immun. 66:
5450.
16. Jensen, T., P. Hansen, S. L. Galli, S. Mouritsen, K. Frische, E. Meinjohanns,
M. Meldal, and O. Werdelin. 1997. Carbohydrate and peptide specificity of MHC
class II-restricted T cell hybridomas raised against an O-glycosylated self peptide. J. Immunol. 158:3769.
17. Galli-Stampino, L., E. Meinjohanns, K. Frische, M. Meldal, T. Jensen,
O. Werdelin, and S. Mouritsen. 1997. T-cell recognition of tumor-associated
627
18.
19.
20.
21.
carbohydrates: the nature of the glycan moiety plays a decisive role in determining glycopeptide immunogenicity. Cancer Res. 57:3214.
Forestier, C., E. Moreno, S. Meresse, A. Phalipon, D. Olive, P. Sansonetti, and
J. P. Gorvel. 1999. Interaction of Brucella abortus lipopolysaccharide with major
histocompatibility complex class II molecules in B lymphocytes. Infect. Immun.
67:4048.
Apostolopoulos, V., M. S. Sandrin, and I. F. McKenzie. 1999. Carbohydrate/
peptide mimics: effect on MUC1 cancer immunotherapy. J. Mol. Med. 77:427.
Kim, J. J., L. K. Nottingham, A. Tsai, D. J. Lee, H. C. Maguire, J. Oh,
T. Dentchev, K. H. Manson, M. S. Wyand, M. G. Agadjanyan, K. E. Ugen, and
D. B. Weiner. 1999. Antigen-specific humoral and cellular immune responses can
be modulated in Rhesus macaques through the use of IFN-␥, IL-12, or IL-18 gene
adjuvants. J. Med. Primatol. 28:214.
Ulrich, R., D. Koletzki, S. Lachmann, A. Lundkvist, A. Zankl, A. Kazaks,
A. Kurth, H. R. Gelderblom, G. Borisova, H. Meisel, and D. H. Kruger. 1999.
New chimaeric hepatitis B virus core particles carrying hantavirus (serotype
Puumala) epitopes: immunogenicity and protection against virus challenge.
J. Biotechnol. 73:141.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017