Immune responses to Fasciola hepatica infection,
and Fasciola hepatica derived antigens
Thesis presented for the degree of
MASTERS OF SCIENCE
by
Alan Walshe, B Sc
Under the supervision of
Sandra O’ Neill, Ph D
School of Biotechnology
Dublin City University
August 2003
1.1 Introduction
1
1 1 1 In troduction
2
1 2 1 L ife cycle o f F a sciola hepatica
3
1 3 1 P ath o lo g y o f F asciolosis
8
1 4 1 In troduction to im m unology
13
151
14
Innate im m unity
1 6 1 A cq u ired im m unity
17
171
T h-cell dich o to m y
19
181
Im m u n o lo g y o f helm in th infections
22
1 9 1 Im m u n o lo g y to F asciola hepatica infection
23
1 10 1 Im m unological evasive strategies o f F h e p a tica
26
1 11 1 F hepatica excretory/secretory products
30
2.1 Materials and methods
33
2 11
M aterials
2 1 2 P rep aratio n o f F hepatica w hole som atic antigen
2 1 2 1 P rep aratio n o f excretory-secretory pro d u cts
34
36
36
2 1 2 2 S eparation o f ES antigens b y m olecular w eight
using a hig h perform ance sephacryl gel filtration
co lu m n and C athepsm L enzym e activity
2.1.3
R eco m b in an t CL1 and M utant CL1
37
37
2 2 1 B C A m easu rem en t o f p rotein concentration
38
2 2 2 B radford assay m easurem ent o f p rotein co n centration
39
2 3 1 M easu rem en t o f cathepsm -L activity using the fluorogem c
substrate Z -phe-arg-N H M ec
39
2 4 1 Sodium dodecyl sulfate polyacrylam ide gel electrophesis
(S D S -P A G E )
39
2 51
Infection and im m unisation o f m ice
40
2 61
S tim u latio n o f m urine spleen and lym ph node cells w ith antigen
41
2 71
M easu rem en t o f m u n n e cytokines b y capture E L IS A
42
2 81
M easu rem en t o f Ig G l and Ig G 2 a isotypes
43
2 91
E x am in atio n o f liver p ath o lo g y
43
2 1 0 1 R everse tra n sc n p ta se po ly n u clear chain reactio n (rtPC R )
43
2 11
S tatistical analysis
45
2 12
D eterm in atio n o f cellu lar profiles
46
3.1 Results
3.1.1 Cytokine, antibody and pathology profiles in
BALB/c mice infected with F.hepatica
46
3 1 1 1 Introduction
47
3 1 2 1 E xperim ental design
47
3 1 3 1 R esults
3 13 11
IL -4 and m terferon-y cytokine production
b y spleen cells o f B A L B /c m ice
infected w ith 10 m e ta c e r c a n a o f F hepatica
at day 7,10,14 and 21 p o st infection
49
3 1 3 1 2 IgGl and IgG2a antibody production m
serum of F hepaticainfected mice
51
3 1 3 1 3 Pathology of liver tissue of mice infected with
metacercana of F hepatica
53
3 1 3 1 4 Early cytokine profile in BALB/c mice infected
with F hepatica
3 1 4 Discussion
62
65
3.2.1 Comparison of immune responses to F. hepatica
and that of F. hepatica excretory/secretory
(ES) products
74
3 2 11 Introduction
75
3 2 2 1 Experimental design
75
3 2 3 1 Companson of IL-4 and IFN-y cytokine production
by spleen cells of BALB/c mice infected with 10
metacercana of F hepatica,, and that of mice
immunised with ES
76
3 2 3 2 Intra-pentoneal cellular profiles m response
to infection with F hepatica
324
excretory/secretory products
79
Discussion
82
3.3.1 Immune responses to F. hepatica derived antigens
85
3 3 11 Introduction
86
3 3 2 1 Experimental design
87
3 3 3 1 Results
89
3 3 3 2 Purification of F hepatica derived antigen
89
3 3 3 3 Antigen specific cytokine production mspleen
cells of mice infected with metacercana
of F hepatica
91
3 3 3 4 Antigen-specific cytokine production in
spleen cells of mice immunised
with F hepatica denved antigen
94
3 3.3 5 IgGI and IgG2a antibody production m
serum of mice immunised with F hepatica
denved antigens
3 3 4 Discussion
99
102
3.4.1 Immunisation with F. hepatica-derived
antigen and various advuvants
105
3 4 1 1 Introduction
106
3 4 2 1 Expenmental design
106
3 4 3 1 Results
107
3.4.3.1 IL-4 and IFN-y cytokine production in
mice immunised with F hepatica-denved
antigen and various adjuvants
107
3 4 3 2 IgGl and IgG2a antibody production m
serum of immunised mice
112
3 4 4 Discussion
115
4.1 General Discussion
119
4 11 Discussion
120
4 2 1 Future recommendations
125
5.1 Bibliography
\
126
I hereby certify that this material, which I submit for assessment on the program
leading to the award of MSc is entirely my own work and has not been taken from
the work of others save and to the extent that such work has been cited and
acknowledged withm the text of my own work
Signed
ID No
Date
Alan Walshe
A b b reviation s
BCA
Bicmchonmic acid
BSA
Bovine serum albumin
CL1
Cathepsm LI
CL2
Cathepsm L2
ELISA
Enzyme linked immunosorbant assay
ES
Excretory / Secretory products
FCS
Foetal calf serum
IFN-y
Interferon-gamma
IL
Interleukin
LFH
Liver fluke homogenate
PAGE
Polyacrylamide gel electrophoresis
PMA
Phorbal,12-mynstate, 13-acetate
PBS
Phosphate buffered salme
pNpp
p-mtrophenyl phosphate
RPMI
Roswell park memorial Institute
SDS
Sodium dodecyl sulphate
Temed
N, N, N, N,4etramethylenediamme
Th
T helper cell
Tris
Tns hydroxymethy-ammomethane
Tween 20
Polyoxymethylenesorbatin monolaurate
recFheCLl
recombinant cathepsm LI
mutFheCLl
mutant cathepsm LI
Acknowledgements
I would like to thank my supervisor, Dr Sandra O’Neill for her help and advice
over the last two years I am also grateful to Professor John Dalton for his support
and advice My thanks to all members of John Daltons Molecular Parasitology
Laboratory, past and present, and to the members of Ildana Biotechnology for
their support and encouragement I would like to thank Dr Sheila Donnelly for her
help with rtPCR Thanks also to Dr Sean Callanan, Brian Keogh and Christy
King, for their assistance in our liver pathology studies
Abstract
The aim of this study was to investigate immune responses as a result of infection
with the parasitic helminth, Fasciola hepatica Analysis of IL-4 and Interferon-y
cytokines described a predominant type 2 immune response m BALB/c mice
infected with metacercana of F hepatica
Levels of IL-4 mRNA assessed by
reverse transcnption-polymerase chain reaction (RT-PCR) provide the first
evidence that the immune response becomes polarised 1 day post infection
also investigated immune responses to F hepatica derived antigens
We
IL-4 and
Interferon-y cytokine production revealed a polarised type 2 response m BALB/c
mice immunised with F hepatica excretory/secretory (ES) products
As type 1
immune responses have been associated with protection against infection with F
hepatica (Mulcahy et a l , 1998), we established a polarised type 1 immune
response in BALB/c mice by immunising with cathepsm L in combination with
various adjuvants
1.1
Introduction
i
I l l In trod u ction
Parasitic helminthic worms comprise a diverse group of metazoan organisms,
which represent an enormous burden on human and ruminant health in most
tropical countries and can cause senous disease in infected populations (Allen &
Maizels, 1997) The impact of helminthic infections is more as a result of the large
numbers of individuals infected, than that of the seventy of the disease (Allen &
Maizels, 1996)
While clinical symptoms of infection may not always be
displayed by the infected individual, disease may anse from an overwhelming
burden of infection, or as a result of an mappropnate immune response
Individuals may become infected concurrently with multiple helminth species, and
can accommodate parasites for several years (Allen & Maizels, 1997) Among the
parasitic helminths, Fasciola hepatica, the causative agent of fascioliasis, exhibits
a wide range of distnbution, with humans, livestock and wild animal infections
being reported on the five continents (Rondelaud et a l , 2000)
Fascioliasis is one of the most common helminth infections of cattle and
sheep, and can result m productivity losses impacting on the economy of the
livestock industry
Economic losses include costs of anti-helmmthics and land
drainage, and losses in productivity as a result of mortality, including reduction m
meat, milk and wool production (Salehaa, 1991) It has been estimated that losses
due to fascioliasis may amount to more than $200 million dollars annually
(Spithill & Dalton, 1998) Fascioliasis is widespread in Ireland and is a particular
problem in areas where high rainfall and poor draining soils combine to
exacerbate the situation
However, the prevalence of infection is significantly
higher m developing countnes (MacDonald et a l , 2002)
Fascioliasis is also recognised as an important disease in humans, with an
estimated 17 million people considered to be infected (Hopkms, 1992) and a
further 180 million at nsk of infection Humans may contract infection via the
consumption of raw vegetables or the consumption of contaminated water
Infections are hypoendemic in areas of South Amenca, Iran, Egypt, Portugal and
France (Esteban et a l , 1997) In Bolivia and Peru, prevalence of infection is
considered to be hyperendemic, and fascioliasis is considered to be a serious
health problem The most sinking levels of infection are recorded m the Bolivian
Altiplano, m which prevalences between 72 and 100% have been observed (Mas
Comma et a l , 1999) It has been estimated that over a quarter of a million humans
are infected in the Bolivian altiplano alone (Hillyer & Apt 1997, O’Neill et a l ,
1998)
Human fasciolosis has also been observed in the European countnes of
France and Spam (Aqona et a l , 1995)
12 1 Life-Cycle of F hepatica
The complex life cycle of F hepatica involves two distinct stages within two
different hosts, the pnmary or definitive host and the secondary or intermediate
host
F hepatica, in general, persists for years in the bile duct of its definitive
host (e g sheep, cattle or human) where it undergoes sexual reproduction The life
cycle entails passage from the pnmary host, into the secondary intermediate host
or vector, an invertebrate (lymnaeid snail) F hepatica utilises the intermediary
host to increase its numbers by asexual reproduction before re-establishment in a
definitive host, where it reproduces sexually thus completing its life cycle
Eggs produced by the mature fluke are passed from the bile duct into the
duodenum and into the faeces of the definitive vertebrate host Embryonation of
3
the eggs occurs once they have exited the definitive host A temperature of
between 10-30°C is required for embryonation In the absence of water eggs will
desiccate rapidly Eggs can remain viable in faeces from three weeks to several
months before they are liberated by the action of ram, deposition of faeces in
water and the trampling of faeces by animals
A “hatching” enzyme (Rowan,
1956) aids in the hatching of the egg, and liberation of the miracidia Hatching
occurs m the presence of light (Roberts, 1950) and ambient temperatures (Gold &
Goldberg, 1976)
The free-swimming miracidia need to find a secondary host
within 24 hours of hatching (Hope Cawdery et a l , 1978)
The secondary host is usually Lymnea truncatula (Boray, 1966), although
other lymnaeid snails may also be infected The snails’ habitat is usually close to
the edge of small ponds or marshy land The mincidium is photosensitive, and
tends to move towards light sources This ensures that it will not waste time
exploring the deeper areas of ponds where L truncatuala does not reside
Stimulant molecules exist in the mucus of snails (Wilson et a l , 1971) to which
miracidia
are attracted A positive chemotactic response by the mincidia occurs
up to a distance of 15 cm (Nehanus, 1953) Specific attachment and subsequent
penetration in L truncatuala is due to the texture of the epidermis (Mattes, 1936)
Penetration of the snail is achieved by mechanical boring by the mincidial anterior
papilla, which are aided by the secretion of proteolytic enzymes (Smith & Halton,
1983) Tissue at the point of penetration is observed to be degraded (Wilson et a l ,
1971)
Upon entry the mencidium transforms to the next larval stage, termed the
sporocyst and migrates to the digestive gland where it proceeds to develop into the
next larval stage, the redia The existence of F hepatica m the secondary host
results in several detrimental effects on the intermediate host, including castration
or decrease in fecundity, increased mortality, destruction of the digestive gland,
metabolic changes (re-allocation of energy from reproduction and growth,
inducing gigantism), increased sensitivity to environmental stress (Gutierrez et a l ,
2000)
Expenmental infections have demonstrated that the F hepatica induces
higher mortality in snails originating from populations with low natural
prevalences than those with high prevalences (Bargues et a l , 1997), indicating
that co-adaptation between host and parasite may occur
The redia move actively
in the hosts tissue and cause considerable damage
Redia multiply to form
germinal cell balls from which the final larval stage, the cercana, is produced
Fully developed cercana emerge from the snail by way of the birth pore
The
mobile, tadpole-like cercana usually leave the snail 4 -7 weeks after infection
Between a few minutes and 2 hours after emergence from the snail, the
cercana attaches by means of a vertical sucker to vanous object including blades
of grass Once attached the body contracts inwards and the outer layer of the cyst
is formed
Simultaneously, as the embryonic “epithelium” is shed and the outer
layer is established, the tail separates from the body
The cyst is immediately
infective to the definitive host Longevity of the encysted metacercana, while
waiting to be consumed by the definitive host, depends on vanous climatic
conditions
Survival for long penods (several weeks-several months) is mainly
dependant on sufficient moisture and moderate temperatures
Major sources of
infection for the definitive hosts are plants associated with water, such as
watercress (Roneldaud et a l , 2000)
5
Withm an hour of infection, metacercana begin to excyst in the small
intestine Metacercanal excystation involves intrinsic factors such as secretions by
the fluke, and extnnsic factors including elevated temperature, pCo2, reducing
conditions, pH and the presence of bile salts There are two stages of excystation ,
a passive active stage and an active emergence stage (Smith, 1981)
The
activation stage occurs in the stomach prior to emergence, and is stimulated by
high levels of C 02 temperature of about 39°C and reducing conditions The
mincidia empties its caecal contents (Sukhedo & Mettnck, 1986), which contain
secretions which affect the inner cyst wall, aiding emergence Bile may be
influential in the emergence phase, and may activate an enzyme secreted by the
parasite enhancing muscular movements of the young fluke (Dixon, 1966) Within
two hours of infection the juvenile liver flukes have bored through the wall of the
intestine by breaking down epithelial cells, connective tissue and muscle fibres,
causing extensive haemorrhage, and can be found m the abdominal cavity en route
to the
liver
Once through the liver capsule, the flukes burrow through the liver tissue
for 5-6 weeks causing extensive haemorrhage and fibrosis
The flukes reach the
bile ducts withm 7 weeks of infection where they develop into sexually mature
adults Flukes become established for a considerable time m the liver
Flukes
residing for a period of 11 years have been recorded m sheep by Durbin (1952)
The fluke is hermaphroditic and self-matmg may occur Eggs are produced by
each fluke after approximately one more week of development The embryonated
eggs are passed from the bile duct into the duodenum and subsequently into the
faeces, thus completing the life cycle
6
I
Fig 1 1 L ife-cycle o f F hepatica (A n d rew s, 1999)
7
13 1 Pathology of F hepatica infection
Flukes travel within and between organs, for a period of 12-16 weeks as they
develop An individual fluke may pass trough the same area of the liver several
times, and as a result, fresh lesions caused by sequential damage may be found in
the same section of tissue
The size of the tracts and the extent of the resulting
damage will increase as the fluke grows to matunty
Tracts have been observed
composed o f blood cells, cellular debns and infiltrate of numerous eosinophils,
macrophages and CD3+ lymphocytes, plasma cells and proliferation of fibrous
connective tissue (Martinez-Moreno et a l , 1999) Eosinophilia is observed at the
early stages, and thereafter during F hepatica infections
Eosinophilia increases
rapidly at the parenchymal stage, and persists at an elevated level after the flukes
have entered the bile ducts (Ross et a l , 1966) Experiments involving sheep have
demonstrated how juvenile flukes induce the formation of granulomatous lesions
in hepatic parenchyma (Chauvin & Boulard, 1996)
Fluke migration leads to
immune mediated damage of liver tissue as infiltrates of immune cells replace
wide areas of hepatic parenchyma (Martinez-Moreno et a l , 1996) The extent of
the inflammatory response increases as the fluke increases m size The level of
infection also affects the pathology, with heavy burdens causing more severe
pathology and earlier termination by death, especially m the case of sheep
Secondarily infected hosts exhibit more severe hepatic damage than that of
primarily infected animals (Martmez-Moreno et a l , 1996)
The seventy of disease vanes depending on the level of infection, the
nutntional plane of the animals and also vanes between animals in a group Acute
fasciohasis may cause sudden death of stock, especially m sheep An early
indication of infection may be the presence of abdominal pain or ascites
Sub-
acute disease is a haemorrhagic anaemia which is slightly more protracted than the
acute disease Acute haemonchosis also causes a fatal anaemia Calves may suffer
from acute fasciolosis in heavy infestations Pallor of mucous membranes, ventral
oedema, wool break, and weight loss are associated with chronic disease Chronic
disease is uncommon in cattle but may manifest m production loss, however sheep
with chronic disease die with obvious signs including the presence of eggs in
faeces
Changes in blood constitution is observed m infected hosts F hepatica
infection is known to cause anaemia m infected individuals, and anaemic
responses have been observed m the presence of late immature and mature flukes
m the bile duct of infected hosts (Martmez-Moreno et al, 1996) Direct feeding on
host blood results in blood loss at a rate of 0 2-0 5ml per day per fluke (Dawes &
Hughes, 1964) Anaemia is not usually associated with the parenchymal stage of
the disease, except in mice (Dawes, 1963), unless the infection burden is severe, in
which case significant mortality coincides with hepatic haemorrhages when the
flukes are migrating to the bile duct
Albumin and immunoglobulins are the major protein components of
plasma
Serum albumin is only produced by the liver whereas leucocytes are
produced at a variety of sites m the body
Therefore, hypoalbummaemia and
hyperglobulinaemia regularly occur in liver fluke infections in all hosts
Liver
damage caused by migrating flukes at the parenchymal stage of infection
compromises liver function Studies by Dalton & Heffeman (1989) demonstrated
that migrating flukes secrete endo-proteinases which may function m parasite
migration Bersain et al (1997) described Cathepsm LI, secreted by F hepatica as
being capable of degrading extracellular matrix and membrane components and
9
thus aids m parasite migration through the tissue of the host In sheep and calves
this parenchymal damage is reflected in the decline in plasma albumin
concentrates (Anderson et a l, 1977) During the biliary stage of the infection, loss
of blood is so severe that the functional capability of the liver is insufficient to
replace lost albumin
Although the liver parenchymal tissue has healed by this
stage, more metacercanae from subsequent infections further damage the liver
Plasma albumin is progressively diminished in infected hosts An elevation m the
levels
of
immunoglobulins
occurs
several
weeks
after
infection
and
immunoglobulins including IgM, IgGl, and IgE persist throughout the infection
(Holmes et a l , 1968)
Activities
m
the
serum
of the
hepatocyte
enzymes
glutamate
dehydrogenase and glutamate-oxaloacetate aminotransferase increase markedly
during early infection, peaking towards the end of the parenchymal stage (Thorpe,
1965) Damage to the bile duct can be indicated by the presence of y-glutamyl
transferase, an enzyme produced by the epithelium of the bile duct, in blood The
peak of y-glutamyl transferase activity follows the peak of hepatocyte enzymes
(Anderson et a l , 1977) The extent to which hepatic enzymes found m the blood
as a result of damage to the liver tissuehas been used to monitor the progress of
infection
Most of the damage caused to the liver tissue appears to be as a direct
consequence of the spines and prehensile sucker action of the liver fluke
Haemorrhaging induced by this damage may result in the death of the host In
infections of mice (Dawes, 1963c), cattle (Dow et a l , 1967) and sheep (Sinclair,
1967) desquamation and ulceration were observed in liver tissue close to the spmy
body of flukes In some cases indentation of spmes in the tissue was observed
10
The fluke obtains the majority of its nutrition by means of its oral sucker, in a
process which can cause considerable damage to the liver
Oral suckers are the
mam organ involved in tissue damage It has been observed by Sukhedo et al
(1988), that chronic ulceration and haemorrhage were associated with areas of
tissue adjacent to oral suckers The ventral sucker which the fluke uses as a hold­
fast organ has also been observed to inflict damage on host tissue (Dawes, 1963)
Enlargement of the bile duct wall and lumen as a result of hyperplasia of the
epithelial and sub-epithelial cells occurs long before the maturing fluke enters the
bile ducts (Dawes, 1963a) Increased concentrations of the ammo acid proline
appear to be an important factor m this process
Infusion of proline in rats
mimicked in part, enlargement of the bile duct by flukes (Modavi & Isseroff,
1984)
An inflammatory response mounted by the host coincides with mechanical
damage caused by the migrating fluke (Dawes, 1963) Studies in sheep (Sinclair,
1968, 1975) demonstrated that an inflammatory response plays a protective role
against damage caused by the invading fluke Fluke tracks fill with cellular debris
and damage to the cells surrounding the tracks is evident Macrophages and
fibroblasts accumulate m older areas of tracks forming scar tissue In hosts with a
heavy burden, fibrosis of the liver becomes severe, and is more evident in cattle
than m other hosts Fibrosis may restnct movement of the fluke Once flukes have
entered the bile ducts the parenchymal tissue recovers and inflammation is
restncted to the epitheha of the bile ducts Treatment of infected sheep with
dexamethasone, an anti-mflammatory agent that kills lymphocytes, permitted
more rapid development of the fluke, and resulted in increased physical damage to
the liver
In treated sheep there was extensive haemorrhaging, little hepatic
11
fibrosis, and no thickening of the bile duct wall
The sheep displayed clinical
signs of illness such as pallor, weakness, weight loss and anaemia These clnical
signs were not observed in infected controls
While the inflammatory response has an important role m the response of
the host to the invading parasite there is also evidence that this response also leads
to hepatic dysfunction Many aspects of liver dysfunction, including bio-energetic
abnormalities, accumulation of non-estenfied fatty acids and depletion of
phospholipids do not occur m fluke infection where the hosts T-cell function was
inhibited (Hanisch et a l , 1991) Oxidative stress imposed on infected rat livers is
as a result of inflammatory cells such as neutrophils, macrophages and
eosinophils, which produce oxygen free radicals, nitric acid and their products It
is important that the host strikes a balance between the protective inflammatory
response against fluke damage to the liver, and the inflammatory response which
leads to dysfunction of the liver
The liver has many functions including metabolism of ammo acids,
carbohydrate and lipid balance, urea synthesis, ketogenesis and detoxification
Therefore, liver fluke infection and subsequent damage to the liver may induce
many systemic changes, leading to reduced productivity m livestock
The
magnitude of the systemic changes generally depends on the extent of the
infection Reduced weight gam m cattle and sheep have two mam causes reduced
feed conversion and anorexia Fluke burdens <200 in sheep do not induce severe
anorexia (Sinclair, 1975), indicating that loss of weight is due to compromised
feed conversion
In sheep with a higher fluke burden anorexia is a consistent
feature of chronic fasciolosis
Animals on poorer diets display more severe
disease symptoms than those on a higher level of nutrition (Berry & Dargie,
12
1976) Experiments (Dargie et a l , 1979) involving heavy fluke burdens of 1000
metacercana in sheep, showed that nitrogen retention was lower after week 8 of
infection, which could account for the difference m body weight, and that the loss
of nitrogen was as a result of increased urinary excretion rather than decreased
intestinal absorption
The liver is important in controlling the concentration of blood glucose
This function is especially important in ruminants as glucose is not acquired
directly from the diet, but is manufactured from a glucose precursor, by the
process of gluconeogenesis Dysfunction m hepatic carbohydrate metabolism may
occur as a direct result of infection with F hepatica
Infected rats show lower
levels of glycogen throughout infection than that of control ammals (Gameel,
1982)
A study of infected sheep (Lenton et a l , 1996) showed that levels of
glucogenesis m the left lobe was impaired, while that of the nght lobe functioned
as normal
Therefore in low to moderate infections of sheep, carbohydrate
metabolism, while compromised m the left lobe, may be compensated for by
activity m the less affected area
1 4 1 Introduction to Immunology
Immunity refers to the mechanisms employed by the body to protect against
environmental agents which are foreign to the body The primary function of the
immune system is to eliminate infectious agents and to minimise the damage they
cause
Animals evolved immune defences to protect against viruses, bacteria,
fungi, protozoa and helminths The immune responses can be classified as either
innate immunity or adaptive immunity
1 5 1 Innate immunity
Innate immunity is a product of evolution Its function does not require a learning
process or active recollection of previous encounters by the individual The
effectiveness of the innate protection is determined by such features as the species
of the individual and the non-specific activity of its tissue cells Innate immunity is
referred to as the defensive elements with which an individual is bom and which
are always present and available at short notice to protect the individual from
challenges by foreign invaders These elements include the skm, surface mucous
layers, and the cough reflex, which present effective barriers to environmental
agents Chemical influences such as pH and secreted fatty acids provide effective
barriers against invasion by many micro-organisms
Innate immunity is also concerned with the early phase of immune responses
dunng which the body employs phylogemtically conserved receptors to identify
and respond to a wide range of components of organisms (Medzhitov & Janeway
J r , 2000) This early response results in a rapid activation of immune system cells
and the subsequent release of a variety of inflammatory mediators
Components
of the innate immune system include dendritic cells (DCs), macrophages and
natural killer (NK) cells Immature DCs are among the first cells to detect
invading microbes (Pulendran et a l , 2001) DCs utilize various receptors to detect
potential pathogens and respond by secreting a number of cytokines (Banchereau
et a l , 2000) Cytokmes are molecules involved m signalling between cells dunng
immune responses
All are proteins or peptides, some with sugar molecules
attached (glycopeptides)
There are a number of categones of cytokmes
including, (i) Interferons (IFNs), which are involved in immune responses to
certain bactenal and viral infections Interferons are involved in the early stages of
14
immune responses and are considered to be the first line of resistance to many
viruses (11) Interleukins (IL), are a large group of cytokines produced mamly by
T-cells, and have a variety of functions, most of which involve the direction of
other cells to divide and differentiate Each interleukin acts specifically on a
limited group of cells which express the appropriate receptor for that interleukin,
and (111) Tumour necrosis factors (TNF) have several functions, including
mediating inflammation and cytotoxic reactions Cytokines such as Interleukin-1
(IL-1), IL-6, IL-12, and IL-18 stimulate the growth of T-helper cells to
differentiate along the type 1 immune response
Cellular components of the innate immune system can detect microbes via
cell-surface
receptors
Stimulation
of
macrophage
receptors
for
lipopolysacchandes m the membrane surface of gram-negative bacteria, induces
the synthesis of chemical signals or cytokines
Macrophages also release
regulatory and effector molecules that can influence the innate response including
IL-12 and NO production (Mittrucker & Kauffmann, 2000), and are a major
component of infiltrate tumors, and promote tumor progression (Mantovam et a l ,
1992)
Resident macrophages which reside m tissue, and neutrophils which
migrate in blood to sites of infection, and are crucial in the innate defence against
bacterial pathogens through their removal and destruction (Aderhem & Underhill,
1999) NK cells are employed early in the immune response as they are the major
source of Interferon-y, a critical macrophage activating cytokine (Schwacha et a l ,
1998)
Also, NK cells have been shown to produce NO (Cifone, 1999), which is
functional m the innate immune response as a regulator of IL-12 mediated
activation of NK cells (Diefenbach et a l , 1999)
The critical elements
characteristic of the innate immune responses are controlled by intracellular
15
interactions between DCs, NK cells and macrophages (al-Ramadi et a l , 2003)
Mast cells and basophils can be activated to secrete cytokines such as IL-4, thus
playing a role in the innate immune response (Wedemeyer et a l , 2000)
IL-5
secretion stimulates the release of eosinophils (Behm & Ovington, 2000)
Eosinophils travel m blood to the site of infection where they become activated
and secrete cytokines, degranulate to release cytotoxic products, and phagocytose
particulate material Their primary function is in the defence against organisms too
large to be phagocytosed (Behm & Ovington, 2000)
The complement system is the major soluble protein component of the
innate immune system It consists of a group of serum proteins that activate each
other in an enzyme cascade system, where the product of one system is the
enzymatic catalyst of the next, to generate biologically active molecules capable
of lysing cells by attacking and forming pores m membranes, inducing
inflammatory responses and opsomsing targets for phagocytosis by granulocytes
and macrophages Complement can be activated m one of three pathways (l) the
classical pathway which is initiated by antigen-antibody complexes, (u) the
alternative pathway, m which complement components become activated by the
cell walls of bactena or yeast, and (111) the lectm pathway that activates the
classical pathway of complement in the absence of the C lq component (Mastellos
& Lambns, 2002)
Once activated, the complement system generates peptides
which have the following effects, (l) opomsation of micro-organisms for uptake by
phagocytosis (11) attraction of phagocytes to sites of infection (m) increased blood
flow to the site of activation and elevated levels of permeability in capillaries to
plasma molecules and
(iv )
damage in plasma membranes of cells
Complement
acts as an effecter system in host defence against invading pathogens, contributes
16
through its activation products to the release of inflammatory mediators, promotes
tissue injury at sites of inflammation, and has been implicated in the pathogenesis
of several autoimmune and vascular diseases (Arlaud et al., 1998). Complement
has been identified as providing a link between innate and acquired immunity by
augmenting the humoral response to T-cell dependant antigens and affecting the
threshold of B-cell activation (Dempsey et al., 1996).
1.6.1 A c q u ire d im m u n ity
Acquired immunity is more specialised than innate immunity, and it supplements
the protection provided by the innate system. In contrast to the innate immune
system the acquired immune system displays specificity, diversity, memory and
discrimination between self and non-self. The efficiency of acquired immunity
depends on the recognition of foreign or new material by specialised cells of the
lymphoid system which once activated differentiate into effector cells which
synthesise functional molecules and memory cells which can be activated
specifically in the event of a second encounter. Central to the adaptive immune
response are a subset of leucocytes, the lymphocytes. Lymphocytes specifically
recognise individual pathogens, whether they are inside the host cells or in the
tissue fluids or blood.
Lymphocytes can be categorised as B lymphocytes (B
cells) or T lymphocytes (T cells).
Immunity is acquired by contact with the
invader and is specific to that invader only. The initial contact with the foreign
agent leads to the activation of lymphocytes and the synthesis of proteins which
exhibit specific reactivity towards the invading agent.
In this manner the
individual acquires the immunity to defend against a subsequent attack by the
same invading agent.
An adaptive immune response is initiated when T cells
17
recognise foreign peptides bound to self-MHC molecules expressed on antigenpresentmg cells (APCs), with the aid of co-stimulatory molecules such as CD80
(Barton & Medzhitov, 2002) T-lymphocytes kill their targets by secreting
cytokines that can ligate pro-apopotic receptors on the target cell, or by recruiting
inflammatory cells into the area of infection (Santamana, 2001) DCs recognise
signs of infection and serve as antigen presenting cell for the activation of naive Tcells (le Bon & Tough, 2002), which is a critical event m the induction of an
adaptive immune response Also, DCs can detect indirect indicators of infections
such as the expression of cytokines by infected cells (Banchereau et al, 2000)
Lymphocytes circulate in the blood and migrate to sites of entrapped
antigen m secondary lymphoid tissue such as the spleen, lymph nodes and Peyers
patches (Clark & Ledbetter, 1994)
pathogens and their products
B lymphocytes combat extra cellular
They are capable of recognising a broad range of
foreign antigens while ignoring self antigens (Kelly & Cahn, 2000) They possess
a receptor which allows them to bind to antigen on pathogens or to secreted
pathogen
products
Following binding,
the
antigen-receptor complex
is
internalised and the antigen is processed by proteolytic cleavage m the endosomes
Basophils and mast cells are associated with acquired immunity involving
antibody-associated immune responses (Wedemeyer et a l , 2000) They are
involved m production and secretion of cytokines (Kmet, 1999), and are regulated
by IgE antibody (Galli & Lantz, 1999) Also, basophils are involved in acute-IgEassociated allergic reactions and contnbute to the expression of aspects of
acquired immune responses that develop over hours, or days to weeks, for
example chronic allergic inflammation (Galli & Lantz 1999)
18
There is a considerable amount of interaction between the innate and the
acquired immune responses and as a result most immune responses to infectious
organisms consist of a combination of innate and acquired responses
Innate
responses predominate in the earlier stages of infection, before the lymphocytes
begin to generate an adaptive immune response Co-stimulatory molecules, needed
for the initiation of an adaptive immune response are regulated by receptors for
microbial products, thereby linking innate recognition of non-self with induction
of adaptive immunity (Janeway, 1989) The magnitude and quality of the adaptive
immune response depends on signals derived from the innate response to infection
(Medzhitov & Janeway, 1997)
The principal cell type associated with the
translation of information from the innate immune response to that of the acquired
system is the dendntic cell (DC)
1 7 1 Th-cell dichotomy
Regulation of immune response is multi-factorial involving appropriate activation,
co-stimulation and the presence of specific soluble factors
Mossman and
Coffinan (1989) observed that Th clones differentiated into two distinct
populations (Thl & Th2), according to the type of cytokines they produced The
Thl/Th2 paradigm subdivides T cell immune responses into those specialised for
defence against intracellular pathogens such as viruses and bacteria (Thl), and a
second involved in the defence against larger extra-cellular pathogens such as
helminths (Th2) Although both populations are derived from a common pre
curser (ThO cells), they exhibit phenotypic and functional differences
The
selective differentiation of CD4+ T cells into effector Thl and Th2 cells is
established during the early stimulation of these cells and is manipulated by
19
various extra-cellular influences including the dose of antigen, the source of costimulation and the cytokine environment (Constant & Botomly, 1997)
Among
these the most influential polarising factor is the cytokine environment
Thl responses employ the cytokines IL-12 and IFN-y to mediate a range of
biological effects designed for intracellular immunity
Interferon-y promotes
germlme transcription at the IgG2a locus and increases the overall frequency of
IgG2a expressing cells (Sevennson et a l , 1990)
Interferon-y stimulates the
production of IgG2a and IgG3 by B cells which may activate the classical
complement pathway, and induces phagocytosis of microbes via binding to the Fc
receptor on macrophages
Interferon-y may also promote the cytocidal and
microbicidal activity of macrophages and hence their ability to produce nitric
oxide
This antibody-independent type of immune defence by activated
macrophages is associated with cell-mediated immunity to intracellular organisms
It can also be employed against extracellular parasites such as helminths (James et
a l , 1982) However the killing is non-specific and host cells m the vicinity of the
reaction may also be damaged hence macrophage activation by type 1 responses
is often associated with pathological conditions (delayed type II hypersensitivity
reaction) such as those observed m chronic infections
In contrast, Th2 responses are characterised by the production of IL-4, IL5, IL-6, IL-9, IL-10 and IL-13 These cytokines aid m B-cell proliferation and the
secretion of IgGl and IgE IL-4 influences the differentiation of naive T-helper
cells into Th2 cells, and has also been shown to play a major role m the expression
of IgGl (Finkelman et a l , 1988), and it has been demonstrated (Kuhn et a l , 1991)
that IgGl is produced at a much lower level in mice lacking IL-4 Th2 responses
cause inflammatory processes designed to expel larger parasites and promote the
20
mobilisation of eosinophils which can release toxic cationic compounds that are
important m the control of helminth infections IL-3 plays a crucial role m the
promotion of allergic inflammatory eosinophilia reactions through IgE isotype
switching (Levy et a l , 1997) However, the stimulation of these cells may also
induce allergic and atopic manifestations, which correlates with the findings that
Th2 derived cytokines may induce airway hyperactivity as well as the production
of IgE (Sher & Coffman, 1992)
IL-13 is also functional m the production of
inflammatory cytokines, the induction of B-cell proliferation and differentiation,
inducing IgE production and m the enhancement of the expression of CD23 and
MHC class 11 molecules (major histocompatabihty complex class 2) (De Vnes &
Zurawski, 1995)
The Th2 cytokine IL-10 has been associated with the down-
regulation of cellular immune responses, and as a result affects the outcome of
infection of bactenal and viral infections by the inhibition of Thl-associated
cytokines
Thl and Th2 immune responses tend to counter-regulate one another
through the action of the cytokines that are specific to each type of response IFNy down regulates Th2 responses, and conversely IL-4, IL-10 and IL-3 can inhibit
the effects of IFN-y, and the development of Thl responses
As a result of the
counter-regulation of the opposing cytokines, a polarisation of the immune
response occurs
1 8 1 Immunology of helminth infection
It has been established that in terms of T-cell responses to helminth infection, Th2
activation correlates with disease (Heinzel et a l , 1998) with a subsequent down
regulation of Thl responses It remains unclear whether Th2 response provide
21
protective immunity against the invading parasite, or are responsible for immune
related pathology, or both (Allen & Maizels, 1996). For example IL-4 knockout
mice generally do not produce protective immunity to helminth infections (Brunett
et a l , 1999). In murine schistosomiasis, an early Thl response is superseded by a
more prevalent Th2 response after egg production.
The development of an immune response to helminth infection may result
in pathological alterations which lead to the primary signs of the disease
(MacDonald et al, 2002). For example, eggs produced by Schistosoma mansoni
may become trapped in the sinusoids of of the liver inducing a Th2 response,
which results in the development of granulomatous lesions (Cheever et al., 2000).
However, infected mice, incapable of producing granulomatous lesions die as a
result of toxic effects of egg protein on hepatocytes (Amiri et al, 1992). The
granulomata function by segregating the egg and allowing continued function of
liver tissue. After the egg has been destroyed, the granulomata resolve, and
fibrosis develops (Cheever et a l 2000).
This may lead to the formation of
varices, the bleeding of which is the most common cause of death in
schistosomiasis (MacDonald et a l,2002).
Elevation of immunoglobulin IgE and tissue eosinophilia are characteristic
of immune responses to helminth infections (Sher & Colley, 1989), and these
responses are regulated by the Th2 subset cytokines, IL-5, IL-4 and IL-3. Infection
with the nematode Nippostrongylus brasiliensis increases IgE serum levels 100
fold over 14 days in rodents (Maizels et a l , 1993). Helminth parasites can be
killed in vitro by IgE-regulated mechanisms, involving platelets, mast cells,
basophils, eosinophils and macrophages (Capron & Dessaint, 1985). IgE-mediated
22
hypersensitivity is associated with pathology rather than resistance in human gut
tnchunasis infections (Cooper et a l , 1991)
The primary function of eosinophils is thought to be in the immune
defence against large organisms such as helminths This observation is based on
the facts that (1) eosinophils can degranulate and kill helminths in vitro (11)
eosinophils aggregate m areas of helminth infection and (111) degranulate in the
vicinity of invading helminths (Butterworth, 1984) However, direct evidence for
eosinophils m host protection in vivo is lacking (Meeusen & Balic, 2000)
1 9 1 Immunology of Fasciola hepatica infection
Although many mammalian species may be infected with Fasciola, there is
variation in the degree of susceptibility to infection, and m the ability to mount an
effective immune response For example, sheep often die from acute fasciolosis,
while some infections may last for as long as 11 years (Pantelouns, 1965)
Different genetic backgrounds may be causative in the differing levels of
susceptibility to infection (Boyce et a l, 1978) In contrast, cattle rarely die from
infection with liver fluke, and display a “ self cure” between 9 and 26 months after
infection This self-cure may be due to the observed thickening by calcification of
the bile duct walls, in chronically infected cattle This immune strategy employed
by cattle is not observed m sheep, and may explain the higher mortality rates
associated with infection of sheep In general, infection m humans tends to cause
high morbidity, and persists in hosts for lengthy periods (Maizels et a l , 1993),
rather than causing high mortality rates
Infection with F hepatica induces a predominant Th2 response
It has
been observed that Th cell clones specific for F hepatica enhanced IgG synthesis
23
through IL-4 expression (Brown et a l, 1999), a characteristic Th2 cytokine
response The capacity to produce IgG2 is associated with the production of IFN-y
(Estes et a l , 1994), and as a result of a polarised Th2 response, the production of
IFN-y, and consequently IgG2 is inhibited This observation is consistent with the
polarised Th2 response observed m chronically infected animals (Clery et a l ,
1996), where IgGl was shown to be the dominant isotype produced in response to
Fasciola infection
Elevated levels of protection against expenmental challenge
have been associated with IgG2 antibodies (Mulcahy et a l, 1998), however this
protective response is down-regulated in the polarised Th2 response characteristic
of infection with F hepatica
Susceptibility to a secondary infection and chromcity is a common feature
of Fasciola infection
For example, the relationship between pathogenesis of
disease and host immune responses was observed m primary and secondary F
hepatica infections of goats (Martinez-Moreno et a l , 1999) The extent to which
infection had been established, measured as the percentage of recovered flukes at
the necropsy, was similar m animals during primary and secondary infections,
however liver damage was much more severe m secondarily infected animals
Primary infection was observed to evolve to chronic fasciolosis that did not induce
the development of resistance, as animals were highly susceptible to secondary
infection, exhibiting severe and acute hepatic lesions that ultimately led to the
death of some of the animals (Martinez-Moreno et a l , 1999) It was also observed
that secondary infection failed to induce any difference in either IgG response or
m the composition of cellular infiltrate of hepatic lesions, although lesions were
more extended m the secondarily infected animals
There was no significant
correlation between the level of antibody titres and the number of flukes recovered
24
at necropsy, suggesting that antibodies have no protective function against
Fasciola infection m primary or secondary infection (Martmez-Moreno et a l ,
1999), this correlates with the observations by Dalton et a l , (1996) who reported
that no correlation was observed between antibody titres and protection against F
hepatica
Animals chronically infected with F hepatica do not acquire a
protective immune response (Clery et a l , 1996), and it has been suggested (Ortiz
et a l , 2000) that animals with chronic infections remain as susceptible to Fasciola
infection as naive animals A similar response to re-infection has also been
observed in sheep (Chauvm et a l , 1995) m experiments in which infected animals
did not develop resistance against secondary infection
While immunohistochemical features of Fasciola infection appear to
suggest vigorous cellular responses against the invading parasite (MartmezMoreno et a l , 1999), these responses are not observed to be protective, as there is
no evidence of effective destruction of Fasciola flukes at any stage of
development
The effector mechanism of protective immunity has not been
clearly established, however reported data suggests that it may occur at the early
stage of infection m three different sites, the wall of the intestine (Charbon et a l ,
1991), the peritoneal cavity (Burden et a l , 1983) and the liver surface of the
parenchyma (Keegan & Trudgett, 1992) The effector response is believed to be
mtnc oxide-mediated killing which involves
attachment of the effector cells
(eosinophils, neutrophils and macrophages) to the tegument (Spithill et a l , 1997)
Eosmophiha is a common feature of Fasciola infection, and eosinophils
have been observed in close association with the surface of damaged newly
excysted juveniles (NEJ), suggesting a role for this cell type in resistance to
Fasciola infection (Burden et a l , 1983) However, Hughes (1987) remarked that
25
there is only circumstantial evidence which shows eosinophils are functional in the
killing of F hepatica NEJ’s Furthermore, it has been demonstrated in vitro that
eosinophils fail to induce irreversible damage on NEJ of F hepatica (Glauert et al,
1985) The fact that the immune responses are induced, but are ineffective against
Fasciola implies that the immune response is ineffective due to a defensive
capability of the parasite (O'Neill et a l , 2001)
1 10 1 Immunological evasive strategies of F hepatica
Flukes may persist in their definitive hosts for extensive periods of time and
therefore must possess means of evading prolonged attack from the hosts’ immune
system F hepatica has developed various mechanisms of immune modulation
allowing its establishment and survival in the liver causing a severe hepatic
disease (Meussen et al ,1995)
While the parasite ultimately resides m the bile duct of the liver, it must
first find safe passage as it migrates through the intestinal wall and liver tissue
Adult worms are generally more resistant to immune effector mechanisms than the
earlier larva stages, suggesting that it has developed more efficient mechanisms
for evasion of the hosts’ immune response As the tegument of the liver fluke is
involved m most of the interactions between the parasite and the host, the liver
fluke surface plays an important role m protection against immune attack Liver
fluke tegumental membrane is covered by a poly anionic glycocalyx consisting of
ganglioside terminating in sialic acids (Threadgold, 1976)
Two experimental
approaches have demonstrated the significance of glycosylation m helminth
infections
First, immunodominant glycosylated epitopes are often the major
targets of natural and experimental host humoral responses, as demonstrated by
26
the loss of antibody recognition through deglycosylation of the parasitic
glycoprotein antigens or destruction of the glyco-epitopes by periodate oxidation
Second, immuno-staining by glycan-recognising monoclonal antibodies or lectins
against whole parasite or parasite derived extracts may show developmental stagespecific expression profiles of glycosylation
The tegumental glycocalyx may aid in immune evasion in several ways, (1)
Antigen
switching,
composition
of the
gly cocalyx
changes
during
the
development of the parasite m the host, thus presenting the hosts’ immune system
with a changing target For example, the glycocalyx coat changes in composition
from Tl-type tegumental cells to T2-type tegumental cells as the fluke migrates
from liver tissue to that of the bile duct Changes in the fluke surface are reflected
m changes in the immune system Host antibodies specific to the Tl-denved
components peak between 3 and 5 weeks after infection, and following their
decline, anti-T2 antibodies can be observed Anti-T2 antibody production in
infected rats declines after the parasite has entered the bile duct (Hanna, 1980)
Various isotypic responses are observed as a result of parasite-induced stimulation
of different lymphoid compartments IgE responses are significantly greater in the
hepatic lymph nodes m comparison with that of the mesenteric lymph nodes or the
spleen, while IgA responses are higher in the mesenteric lymph nodes
This
provides evidence of a unique regulation of the cytokines secreted by T cells m
each of these micro-environments It has been suggested (Meeussen & Brandon,
1994) that by migrating between different tissue types, which are predisposed to a
specific type of immune response, the flukes may be protected from tackling a
single immune response that would otherwise become increasingly efficient as the
parasite migrates
27
(n) Antigen shedding, as a result of the flukes altenng glycocalyx,
antibody-bound immune effector cells, such as eosinophils and neutrophils may
not bind sufficiently with the parasite to allow degranulation and damage to the to
the surface, but are shed with the glycocalyx (Duffus & Franks, 1980, Hanna
1980)
Glycocalyx turnover slows down once the bile duct is reached, as
migration is completed and the fluke is no longer under such vigorous attack (111)
Antigen decoy, shed products of the glycocalyx may act to “mop up” circulating
anti-fluke antibodies preventing their participation m direct attack on the fluke
(Duffus & Franks, 1980)
Newly excysted juveniles are highly resistant to complement Terminal sialic
acids in the glycocalyx prevent the activation of complement by the alternative
pathway (Baeza et a l , 1994a) The shedding of antibody from the flukes surface
may prevent activation of complement by the classical pathway
It has been observed (Maarmez-Moreno et a l , 1999), that immune
inflammatory cells are rarely found m close association with the flukes, which
would otherwise be expected to be instrumental m mounting a destructive strategy
towards the invading pathogen This suggests an evasive strategy employed by the
fluke in avoiding contact with the immune inflammatory cells This may be
explained by the lack of CD3+ T cells in the infiltrate surrounding tracts made by
migrating parasites inhibits immune inflammatory cells from migrating through
the liver parenchyma This hypothesis is supported by the involvement of Fasciola
excretory/secretory products m the suppression of peripheral blood lympocytes
(PBL) proliferation (Martmez-Moreno et a l , 1996) A further possible evasion
strategy employed by the fluke is the rapid migration by the parasite through the
liver, as has been previously reported in goats (Maannez-Moreno et a l , 1999) and
28
sheep (Meeusen et a l , 1995), which makes it impossible for the leucocytic
infiltration around the parasite (Chauvm et a l , 1995)
Liver flukes also possess an ability to disable immune effector cells, for
example by inactivating the toxic reactive oxygen products of the respiratory burst
of leukocytes (eosmophila and neutrophils) and macrophages or reactive nitrogen
intermediates generated by macrophages (Piedrafita et a l , 2000)
Oxygen
scavenging enzymes such as superoxide dismutase (SOD) may be involved m the
inactivation of oxygen species (Brophy et a l , 1990) Piedrafita (PhD Thesis,
1995) observed increased activity of SOD m extracts of newly excysted juveniles
SOD has also been detected in the excretory/secretory product of adult flukes
(Tang et a l , 1994)
It has been observed (McGomgle et a l , 1997) that adult
flukes release a peroxiredoxm-like enzyme which may protect flukes against
hydrogen peroxidase and other reactive oxygen intermediates
Goose (1978) observed that medium in which liver fluke had been cultured
in was toxic to spleen cells
He observed that these excretory/secretory ES
products could prevent in vitro killing of newly excysted juveniles by pentonealmflammatory cells m the presence of immune serum by inhibiting the binding of
effector cells to parasites
Dalton and Heffeman (1989) demonstrated that liver
flukes secrete two cysteine proteinase activities which are involved m host tissue
penetration and feeding as well as immune evasion
Subsequent studies showed
these enzymes were cathepsm L proteinases, termed cathepsin LI and cathepsin L
2 These molecules can specifically cleave immunoglobulins (Dowd et a l , 1994)
It was also demonstrated that purified cathepsm L could inhibit the antibody
mediated attachment of eosinophils to newly excysted juveniles (Carmona et a l ,
1993)
29
1 1 1 1 F hepatica excretory/secretory products
Proteases catalyse the cleavage internal peptide bonds between peptides and
proteins and are involved in a wide range of eukaryotic processes Proteases are
also known to required for the virulence of pathogenic agents including helminth
infections
It has been demonstrated (Dalton & Heffeman, 1989) that immature
and mature flukes secrete endo-protemases into culture medium when maintained
in vitro
Several functions have been suggested for the role of these enzymes
including functioning in migration through host tissue (Dalton & Heffeman,
1989), the acquisition of nutnent (Smith et al, 1993) and evasion of host immune
responses (Dalton & Heffeman, 1989) Two cysteine proteases were isolated and
characterised as having physiochemical properties similar with the mammalian
lysosomal cathepsin L protemases (Dowd et a l , 1994)
The two enzymes were
observed to differ m their specificities for hydrolysing peptide bonds (Dowd et a l ,
1994) and as a result were termed cathepsm LI and cathepsm L2
McGomgle and Dalton (1995) isolated another antigen containing a haem
group from flukes maintained m culture medium, which was shown to be a liver
fluke haemoglobin (Hb) (Dalton and McGomgle, 1995)
Hb is involved in the
aerobic respiration of immature flukes and egg production m adult flukes
(Bjorkman and Thorsell, 1963) Because the cathepsm LI, cathepsm LI and Hb
molecules are involved m processes functional in the survival of the parasite in the
host, they have been used as potential targets for liver fluke Investigations have
been earned out to test the viability of these molecules for use as vaccines (Dalton
et a l , 1996), where individual molecules, and combinations of the molecules
were given to cattle, to investigate their immunoprophylactic potential It was
observed that cattle immunised with cathepsm LI induced protection against
30
experimental challenge of 53 7%, while animals vaccinated with cathepsin L2 and
Hb were also protected A combinational vaccine containing cathepsin L2 and Hb
induced the highest level of protection (72 4%) Flukes recovered from this group
were smaller in size than that of control groups, indicating that vaccination had
stunted fluke growth, and as a result less liver damage was observed
In a similar study (Wyffels et a l , 1994) in sheep it was observed that
animals immunised with a thiol-cathepsin-related proteinase of M(r) 28,000,
developed antibodies to the cysteine ptoteinase prior to infection with
metacercana o f F hepatica On completion of the tnal, there was no difference in
worm burden between animals which had been immunised prior to infection and
that of infected animals which did not received the proteinase However, faecal
egg counts and therefore worm fecundity was significantly decreased in the
immunised animals
Diagnosis of fasciohasis m the human host is achieved by the observation
of eggs in faeces
As flukes begin to release eggs 8 weeks after infection,
diagnosis of the disease by coprological methods can not be achieved pnor to this
time point Purified protemases secreted by the parasite have recently been used in
the diagnosis of human fasciohasis
An IgG4-ELISA has been established
(O’Neill et a l , 1998) which uses purified cathepsin LI or recombinant protein
expressed m yeast as antigen The result of this report demonstrated the potential
for the development of a standardised assay for the diagnosis of fasciohasis in
humans
Cathepsin LI, one of the major molecules of fluke excretory/secretory
product, is secreted at each stage in the development of the parasite, and has
shown to be highly immunogenic in infected animals
This molecule has the
31
ability to cleave host immunoglobulin and can inhibit in vitro attachment of
eosinophils to newly excysted juveniles (Carmona et a l , 1993) Cathepsin LI is
also capable of degrading extracellular matrix and basal membrane components
and thus aids in parasite migration through the tissue of the host (Berasam et al
1997) The ability of cathepsin LI and cathepsin L2 to produce vasoactive kinnms
in alkaline pH may qualify them as factors of virulence in fascioliasis, since the
intrinsic vasodilation activity exhibited by kirnns, associated with endothelial
leakage and anti aggregation platlet activity might assist m the migration and
survival of the parasite in the tissue of hosts
Adult flukes secrete a cysteine protease capable of cleaving host IgG close
to the papain binding site, and this hampers the hosts immune response to the
invading parasite
Immature flukes also secrete a papain or cathepsin B-like
proteolytic enzyme which cleaves immunoglobulins of mice, rats and sheep in
vitro (Chapman & Mitchell, 1982)
32
2.1
Materials and Methods
33
2 11 Materials
Sigma-Aldrich Ireland Ltd (Tallaght, Dublin)
Di-sodium Hydrogen phosphate, Ethanol, Ethidium bromide, Extra Avadin,
Foetal Calf Serum, Isopropanol, Mercaptho-ethanol, p-Nitrophenyl Phosphate
Tablet Sets, PCR master mix, Potassium Chloride, Phorbol Mynstyl Acetate,
RNAse free water, Sodium Chlonde, N,N,N\N'-tetramethylethylenediamme,
Tn-reagent, Trypan Blue
Stratagene (La Jolla, California, U S A )
IL-4 p-Actm and Interferon-y forward and reverse pnmers
Bachem Limited (Merseyside, England)
Z-phe-arg-MHMec
Becton Dickinson & Co (Oxford, England)
Purified rat anti-mouse IL-4, Purified rat anti-mouse IL-5 Purified rat anti­
mouse IL-10, Purified rat anti-mouse Interferon-y, Biotm conjugated rat anti­
mouse IL-4, Biotm conjugated rat anti-mouse Interferon-y, Biotm conjugated rat
anti-mouse IL-5, Biotm conjugated rat anti-mouse IL-10, Anti-Mouse IgGl,
Anti-mouse IgG2a
Harlan U K Limited (Blackthorn, England)
BALB/c Mice
34
Campton Paddock Laboraties (Thatcham, England)
Fasciola hepatica Metacercanae
GibcoBRL, Life Technologies (Paisley, England)
Penicillm-Streptomycin(5000jLi/5000(ig),L-Glutamme(200mM)J
RoswelPark Memorial Institute(RPMI) 1640 Medium
Pierce and Warrmer (Chester, England)
Amv Reverse transcriptase, Bicimchonmic acid (BCA) Protein Assay Reagent
Kit, Mixed set nucleotides(dATP, dGTP, dCTP, dTTP), lOObp DNA Ladder
Amersham Biosciences U K. Limited (Bucks, England)
High Resolution Sephacryl Gel S-300
35
Methods
2 1 2 Preparation of F hepatica whole somatic antigen
Adult flukes were obtained from the infected livers of condemned cattle at a local
abbattoir Flukes were washed six times in phosphate-buffered saline (PBS) (0 14
M NaCl, 2 7MKCL, 1 5mM KH2P 04 and 8 ImM Na2P04H), pH 7 3 in order to
remove debris
They were then homogenised in a Thyrister Regler homogemser
with 10 ml of stenle PBS The homogenate was centrifuged at 13,000 X g for 30
minutes
The supernatant containing soluble antigen, termed liver fluke
homogenate (LFH) products was removed, ahquoted into 1ml vials and stored at
20°C (Dalton & Heffeman, 1989) Protein concentration of the liver fluke antigen
was calculated using BCA protein assay reagent kit (Section 2 2)
2 1 2 1 Preparation of excretory-secretory products
Excretory-secretory products were prepared as described by Dalton and
Heffeman, (1989) Adult flukes were cultured in vitro for 24 hours in 150 ml of
RPMI-1640, pH 7 3, containing 2% glucose, 30mM Hepes and 25jig/ml
gentamycm at 37°C
The culture media was renewed after eight hours, and the
flukes were incubated for a further 12 hours
The culture media from both
incubations were pooled and centrifuged at 13,000 X g for 30 minutes to remove
eggs The supematent (E S products) was filter sterilised and concentrated to 10
ml using an Amicon 8500 Ultrafiltration unit Amicons containing Ym3 filtration
membranes with a 3,000 mw cut-off point
Aliquots of 1 ml of concentrated
antigen were then stored at -20°C
36
2 1 2 2 Separation of ES antigens by molecular weight using a high
performance sephacryl gel filtration Column.
A haemoprotem fraction and cathepsm L were purified from ES products as
described by Dowd et a l , (1994) and Smith et a l , (1983) The ES sample (4ml)
was applied to a Sepacryl S300HR gel filtration column (2 5cm x 55cm)
equilibrated m phosphate buffered saline (PBS), pH 7 2 Fractions of 3 mis were
collected after a void volume of 45mls was passed Each of the fractions were
monitored for protein concentration using a BCA protein assay reagent kit and an
Amicon 2001 micro-titre plate reader set to 560nm Fractions were monitored for
cathepsm L activity using the fluorogemc substrate, Z-phe-arg-NHMec (Section
2 3)
Fractions containing the higher molecular weight bands and no cysteine
protease activity were pooled and concentrated to 5ml using an Amicon
ultrafiltration umt and termed peak 1
Fractions containing cysteine protease
activity were pooled, concentrated and termed peak 2
2 1 3 Recombinant CL1 and Mutant CL1
recFheCLl and mutFheCLl were purified from yeast medium using affinity
chromatography for the HiS6 tag using Ni-NTA agarose (Qiagen) Gene sequences
for both recFheCLl and mutFheCLl were cloned into a Pichia pas tons vector
containing the a-factor yeast signal sequence
After transformation into GS115
strain of P pas tons, clones were grown in YPD (yeast extract, peptone, dextrose)
media and secretion of the cathepsm proteins induced by addition of 1% methanol
(Collins et a l , in press)
A 1 ml column was equilibrated by passing 10ml 50mM sodium phosphate
buffer, pH 8 0, containing 300mM NaCl and lOmM imidazole, through the
37
column A 40ml sample of the same buffer/NaCl/imidazole mix with yeast media
supernatant (10ml) was then added to the column The column was washed with
15ml 50mM sodium phosphate buffer, pH 8 0, containing 20mM imidazole and
300mM NaCl
The purified protein was eluted using 50mM sodium phosphate
buffer, pH 7 0, containing 250mM imidazole and 300mM NaCl
Purified
recombinant proteins were then dialysed into IX Phosphate Buffered Saline
(PBS)
2 2 1 BCA measurement of protein concentration
Protein concentrations (0 2-2mg/ml) were calculated using a BCA Protein Assay
Reagent Kit according to the manufacturers instructions Briefly, lOfil of sample
of unknown concentration and standard was added to wells on a 96-well microtitre plate Bovine serum albumin was used as a protein standard (0 2-2 0mg/ml)
BCA reagent (1 part reagent B 50 parts reagent A) was added m 200|il volumes,
and the plates were incubated at room temperature for 30 minutes
The
absorbance of the reaction solution was measured at 560nm on an Anthos 2001
micro-titre plate reader Protein concentrations were determined by comparison of
the absorbance of the unknown samples to the standard curve prepared using the
protein standards
2 2 2 Bradford assay measurement of protein concentration
Protein concentrations within the range of 10|ig/ml-1000jag/ml were measured
using a Bradford protein assay (Bradford et a l , 1976) Briefly, lOjil of unknown
sample was brought to a final volume of 800|il with water The protein standards
38
employed were bovine serum albumin at concentrations of 1Ofig/ml-1OOOug/ml
200 jj1 of concentrated Biorad reagent was added and the sample was allowed to
incubate for 5 minutes
Samples were measured at 595 nm on an Anthos 2001
micro-titre plate reader Protein concentration was determined by companson of
the absorbance of the unknown samples to the standard curve prepared using the
BSA standards
2 3 1 Measurement of cathepsm-L activity using the fluorogenic substrate Zphe-arg-NHMec
Cathepsin L activity was measured flourometncally using Z-phe-arg-MHMec as
substrate (Barrett & Kirschke, 1980)
Assays (210|al volume) were performed
with substrate at a final concentration of 10]Lim m 0 1 M, Tns-HCL, pH 7 0,
contaimng 0 5mM dithiothreitol on a 96 well micro-titre plate
Plates were
incubated at 37°C for 30 minutes and the reaction stopped by the addition of 50|il
of 10% acetic acid The amount of 7-amino-4-methylcouramm (NHMec) released
was measured using a Perkin-Elmer fluorescence spectrophotometer with
excitation set at 370 nm and emission at 440nm One unit of enzyme activity was
defined as the amount which catalysed one jimole of NHMec per minute at 37°C
2 41 Sodium dodecyl sulfate polyacrylamide gel electrophesis (SDS-PAGE)
ES, peak 1 and peak 2 were analysed by one dimensional, denatunng 12% SDSPAGE, using the buffer system of Laemmli, (1970)
The running gel was
prepared using 12% (w/v) acrylamide, 0 27% (w/v) bisacrylamide, 0 373 M TnsHCL, pH 8, 0 1% (w/v) SDS, 0 03% (w/v) ammonium persulphate and 0 08%
TEMED
The stacking gel contained 3% (w/v) acrylamide, 0 08% (w/v)
39
bisacrylamide, 0 125 M Tns-HCL, pH 6 8, 0 075% (w/v) ammonium persulphate,
0 1% (w/v) SDS and 0 023% (w/v) TEMED Samples were prepared in reducing
sample buffer (0 12 M Tns-HCL, pH 6 8, containing 5% (w/v) SDS, 10% (w/v)
glycerol, 0 01% (w/v) bromophenol and 5% 2-mercapthoethanol) Samples were
boiled for two minutes Gels were run in a vertical slab gel apparatus m electrode
buffer (25 mM Tns-Hcl, 192mM glycine and 0 1% SDS, pH 8 3) at 25 mA at
room temperature A voltage of 8V/cm2 was applied and the gel was run until the
bromophenol blue dye reached the bottom of the gel Proteins were visualised by
soaking the gel m a solution containing 0 1% (v/v) Coomaissie Bnlliant Blue R,
20% (w/v) methanol and 10% acetic acid for one hour at room temperature The
gel was destained with 20% (v/v) methanol and 10% (v/v) acetic acid
2 51 Infection and immunisation of Mice
Female BALB/c mice (aged 8-12 weeks) were purchased from Harlan U K Ltd
(Blackthorn, Engalnd)
All mice were maintained under the guidelines of the
Department of Health and Children and were 8-12 weeks old at the initiation of
each expenment Animals were infected with metacercana of F
hepatica
purchased from Campton Paddock Laboratones (Thatchem, England),
15
metacercana were administered orally to individual animals Immunised animals
were
injected
mtrapentoneally
with
antigen
denved
from
F
hepatica
excretory/secretory products The mice were sacnficed by cervical dislocation,
and the spleens, hepatic lymph nodes and mesentenc lymph nodes removed
Blood was collected by cardiac puncture and serum was obtained following
centrifugation at 2,000 X g for 5 minutes
2 61 Stimulation of murine spleen and lymph node cells with antigen
Spleens and lymph nodes were removed aseptically Cells were crushed on a wire
grid to form single cell suspensions m RPMI 1640 medium containing 8% heat
inactivated foetal calf serum, penicillin (lOOug/ml), streptomycin (lOOug/ml)
glutamine (2mM) and 2ME (5X105 M)
Cell debns was allowed to settle for 10
minutes, after which time the supernatants were removed and centrifuged at
12,000 revolutions per mmute The cells were then washed with 2ml of RPMI
The number of viable cells was determined by creating a mixture of 96|il
Bromophenol Blue, 100|il RPMI 1640 medium (containing penicillin (100 U/ml),
streptomycin (lOOug/ml) glutamine (2nM) and 2ME (5X105 M) 2% glucose), and
4|il of cell suspension
The number of viable cells (transparent) or non-viable
cells (blue) were counted by using direct microscopic counts with a
haemocytometer and an Olympus B201 microscope, and the concentration
adjusted to 1 X106/ml for spleen cells and 2 X 106 /ml for lymph nodes
Spleen
and lymph nodes were stimulated in vitro m 96 well plates by the addition of
varying concentrations of antigen (ES l-10|ag/ml, LFH 1-lOjig/ml, peak 1 1lOjig/ml, peak 2 1-lOfig/ml, Peak 3 l-10|ig/ml,
recFheCLI l-10|ig/ml
mutFheCLl l-10|ig/ml and
PMA/a-CD3 and stenle PBS were added to additional
wells as positive and negative controls, respectively The cells were incubated in a
CO2 incubator for three days at 37°C
50jil of supernatant was removed after 72
hours to measure IL-4, IL-5, IL10 and IFN-y cytokine production All tests were
performed in triplicate and experiments repeated 2-3 times
41
2 71 Measurement of murine cytokine by capture ELISA
Antigen-specific and non-specific IL-4 and IFN-y were measured by capture
ELISA Plates were coated with 50|il of capture antibody (Beckton Dickenson &
Co ) (l^g/m l), and allowed to incubate at 4°C overnight Plates were washed six
times m PBS 10 1% Tween 20
Excess protein binding sites were blocked with
200|al of skimmed milk (lmg/ml)
The wash step was repeated and 50jal of
supernatant or standard (recombinant IL-4/IFN-y) (Beckton & Dickenson & Co )
were added m triplicate and the plates incubated overnight at 4°C
The washing
step was repeated and the biotm labelled anti-IL-4/IFN-y monoclonal detector
antibody (ljjg/ml) (Beckton & Dickenson & C o ) m IX PBS was added to each
well and the plates incubated at room temperature for an hour
After a further
washing step 100|il of avidin-alkalme phosphatase (0 4(al/ml) in IX PBS, was
added to each well and the plates incubated at room temperature for 30 minutes
The washing step was repeated and
IOO jliI
of p-Nitrophenyl Phosphate (pNpp)
(Sigma Aldnch) (lmg/ml) in 0 2 M Tns buffer was added to each well to detect
bound antibody
The plates were allowed to develop m the dark until the top
standard displayed an absorbance value of 1 absorbance unit at 405nm
Standard
curves were used to determine cytokine concentrations Concentration values for
IL-4 and IFN-y were expressed as pg/ml and ng/ml, respectively
42
2 81 Measurement of IgGl and IgG2a isotypes
Microtitre-plates were coated with 100|al of ES or CL1 (5jag/ml) and allowed to
incubate overnight at 37°C
The plates were washed and excess protein binding
sites were blocked by adding 200jal of skimmed milk (lmg/ml) to each well for
two hours at room temperature
After a further wash step, serum samples were
titred at a dilution of 1 100- 1 218,700, and left to incubate for one hour at 37°C
The wash step was repeated and alkaline phosphatase conjugated anti-mouse IgGl
and IgG2a (Beckton Dickenson & C o ) (diluted at 1 500, 1 1000 respectively in
IX PBS) were added
final washing,
IO O jlxI
The plates were incubated at 37°C for one hour
After a
of p-Nitrophenyl Phosphate (pNpp) (lmg/ml) in 0 2 M Tns
buffer was added to the plates to detect bound antibodies
on an Anthos 2001 microtitre plate reader at 405nm
The plates were read
The antibody titre was
expressed as log titre
2 91 Examination of liver pathology
At post mortem examination, hepatic tissue was fixed m 10% neutral-bufferedformahn Following fixation the tissues were paraffin embedded, cut at 4|im and
stained with haematoxyhn and eosin
2 101 Reverse transcriptase Polynuclear chain reaction (rtPCR)
Total RNA was extracted from cell preparations of spleen and lymph node tissue
using the one step method as described by Chomczynski and Sacchi (1987)
Briefly, cells (IX 106) were lysed m Tn-Reagent (Sigma) Nucleic acid was
separated from proteins by the addition of chloroform (200jal), and incubated at
room temperature for 15 minutes, followed by centrifuging at 12,000 X g for 15
43
minutes The aqueous layer was removed and RNA precipitated by incubation at
room temperature for 10 mm m the presence of isopropanol, followed by a
centrifugal step at 12,000 X g for 15 mm The supematent was removed and the
RNA pellet washed by the addition of 75% ethanol and centrifuged at 7,500 X g
for 10 mm
The resultant was resuspended in 50|il of RNAse free water and
stored at -20°C
Complementary DNA was prepared by reverse transcription using the
following components in sterile 0 5ml microfuge tubes 2 (il 10X reaction buffer,
4 jil 5mM MgCh, 2 |il ImM DNTP, 3 jil OhgoDT(lug/ml), 50 units RNAse
inhibitor, 1 \x\, 20 umts AMV Reverse transcriptase and
l|ig RNA cDNA
reaction mixtures were incubated for 10 mm at room temperature to facilitate
binding of oligodT primer, and cDNA was transcribed at 42°C for lh The AMV
reverse transcnptase was heated to 99°C for 5 mm
A 5|il aliquot of cDNA was subjected to PCR with forward and reverse
primers specific to IL-4, IFN-y, and p-Actm (Table 2 1) Each PCR reaction
contained the following IX PCR Buffer, 0 2mMdNTP, 1 5mM MgCh 25 units
taq and RNAse free water to a final volume of 25|il DNA was amplified using a
thermocycle (PCR Express-Thermo Hybrid), under the following conditions, 95°C
for five minutes, followed by five cycles at 95°C, 55°C and 72°C, respectively
each for a duration of one minute, and a final extension step of 72°C for 7 min
PCR products were separated on a 1% agarose gel (w/v m IX TAE) by
electrophoresis, and visualised using ethidium bromide
44
Table 2 1 PCR pnmers
Primer
Sequence 5’-3’
Product size
(bp)
p-Actin
AT GG AT GACGAT ATCGCT
600
forward
p-Actin
ATGAGGT AGTCTGTC AGGT
reverse
IL-4 forward
ACGGAGATGGATGTGCCAAA
279
CG
IL-4 reverse
CGAGTAATCCATTTGCATGA
TGC
IFN-y forward
TATTGCCACGGCACAGTCAT
405
TGA
IFN-y reverse
GCAGCGACTCCTTTCCGCTTC
CT
2 11 Statistical Analysis
All statistical analysis was performed using SPSS for windows (version 110)
Analysis of the effects of antigen concentration, antigens and time were performed
using factorial analysis of variance Post-hoc significance testing was by Tukey’s
HSD
45
2 12 Determination of cellular profiles
Intra-pentoneal cellular profiles were determined by counting cells in three fields
of vision per sample An average number of cells was determined per sample
46
Results
3 .1.1
Cytokine, antibody and pathology profile in
BALB/c mice infected with F. hepatica.
46
Introduction
3 1 1 1 Fasciolosis is associated with the induction of T-cell responses polarised
towards the Th2 subtype Th2 clones, but not Thl clones have been isolated from
chronically infected cattle (Brown et a l , 1994, Clery et a l , 1996, Mulcahy et al,
1999) Previous investigations performed m our laboratory, by O’Neill et a l ,
(2001) demonstrated a polarised type 2 immune response as a result of F hepatica
infection m rodents, with significant levels of the type 2 cytokine, IL-4 recorded
21 days post infection, while production of the type 1 cytokine, IFN-y was not
observed
In the present study we investigated the T-cell and antibody production of
BALB/c mice exposed to infection of F hepatica over a penod of 21 days We
also sought to determine at what stage of infection the immune response becomes
polarised towards a type 2 response, by measuring early IL-4 mRNA levels Our
data confirms that a polansed type 2 immune response is induced by infection
with F hepatica, and that this response can be detected as early as day 1 post
infection
Histological investigations of liver tissue taken from F hepatica
infected mice, demonstrated the extent of tissue damage as a result of infection
Experimental design
3 1 2 1 To examine the cytokine profile of BALB/c mice infected with F
hepatica over a penod of three weeks, 16 female BALB/c mice (8-10 weeks) were
orally infected with 10 metacercana of F hepatica Four animals were sacnficed
by cervical dislocation on days 7, 10, 14 and 21 Groups of four non-infected mice
were used as controls at each time point Isolated spleen cells (5xl06/ml) were
47
stimulated in vitro at 37°C with ES (5|ng/ml, 1jig/ml), LFH (5jug/ml, l|ig/ml) and
PMA/anti-CD3 as a positive control and medium as a negative control
Supernatant samples were removed after 72 hours and the amount of IL-4 and
IFN-y cytokines that were secreted into culture media was measured (Fig 3 1)
Serum was obtained via cardiac puncture, and circulating anti-fluke IgGl and
IgG2a antibodies were measured
Liver tissue samples were obtained and
examined using haematoxyhn and eosin
Liver tissue damage and cellular
infiltration during F hepatica infection was measured at days 7, 10, 14 and 21
Groups of four non-infected (control) mice were included at each time point as
negative controls Isolated livers were fixed in formalin, cut at 4 jam and stained
with haemotoxyhn and eosm
In order to measure early cytokine responses to infection with F hepatica,
the levels of mRNAs associated with cytokine production were assessed by
reverse transcnption-polymerase chain reaction (rtPCR), at 0, 1, 2, 4 and 8 days
post infection in lymph node tissue of F hepatica infected mice An infection of
10 metacercana of F hepatica was administered orally to 15 BALB/c mice aged
8-10 weeks Groups of three animals were sacrificed by cervical dislocation on
each of days, 0, 1,2, 4, and 8 Groups of three non-infected mice were used as
controls at each time point RNA was extracted from cells of mouse hepatic lymph
nodes and mesenteric lymph nodes at each time point, and mRNA production with
specificity for IL-4 and IFN-y was investigated The positive control, p-Actin
proved positive for each sample at each of the time points
48
Results
3 13 11 IL-4 and interferon-y cytokine production by spleen cells of BALB/c
mice infected with 10 metacercana of Fasciola hepatica at day 7, 10, 14 and
21
The results (Fig 3 1) demonstrate that spleen cells of infected mice stimulated
with ES and LFH, exhibit a predominant type 2 immune response, with significant
amounts of IL-4 cytokine being produced The amount of IL-4 cytokine produced
increased with time from infection, with the greatest cytokine response observed
at day 21 Also, cells stimulated with the higher concentration of antigen (5|ig/ml)
produced a greater cytokine response than that of cells stimulated with the lower
concentration (l|ig/m l)
Cells stimulated with LFH produced a greater response
than that of cells stimulated with ES Levels of IFN-y cytokine secretion was
lower than that expected of a positive response Spleen cells from naive mice
(controls) did not secrete either IL-4 or IFN-y cytokines m response to Fasciola
antigen Stimulation of spleen cells with PMA and anti-CD3 demonstrated that all
cells were capable of producing both Thl and Th2 cytokines (data not shown)
Analysis of the effects of antigens, antigen concentration and time were earned
out by factonal analysis of vanance
Post-hoc significance was by Tukey HSD
Cytokine production was expressed as the mean cytokine concentration of four
mice per group tested in tnphcate
49
□ E S 1 u g /m l
M E S 5 u g /m l
H L F H 1 u g /m l
B LFH 5 u g /m l
D ay 7
D a y 10
D a y 14
D a y 21
B
50
45
1 40
O)
| 35
E
S 30
□ ES 1 ug/ml
c
o
^ E S 5 ug/ml
d)
^ LFH 1 ug/ml
® 25
^ 20
■ LFH 5 ug/ml
15
10
5
0
Day 7
Day 10
Day 14
Day 21
Fig 3 1
Fig 3 1Antigen-specific IL-4 (A) and IFN-y (B) cytokine released from spleen
cells obtained from BALB/c mice infected with 10 / hepatica metacercaria
so
Spleen cells were culture in vitro with ljig/ml and 5jag/ml LFH and ES antigen,
and the supernatant removed after 72 hours for measurement of cytokine
production by ELISA All tests were earned out in tnphcate, and the expenment
repeated twice
3 13 1 2
IgGl and IgG2a antibody production in serum of F hepatica
infected mice
Specific antibody isotypes charactenstic of Thl (IgG2a) and Th2 (IgGl) responses
were measured in serum samples taken from mice infected with 10 F hepatica,
metacrcanae at days 7, 10, 14 and 21 Titres were measured against ES in all
samples Antibodies of the IgGl subtype were detected in all infected animals at
days, 10, 14 and 21 (Fig 3 2) Antibody production observed at days 14 and 21
was higher than levels recorded on day 0, 7 or 14 The most significant levels of
antibody production were observed at days, 14 and 21 No anti-ESIgG2a antibody
production was detected at any stage over the course of infection No specific
IgGl nor IgG2a antibodies were detected m non-infected mice which were
established as controls at each time point
51
45000
40000
35000
30000
25000
lgG1 Titre
20000
lgG2a Titre
15000
10000
5000
0 g0
Fig 3 2 Titres of IgGl and IgG2a antibody production specific for ES, in serum
of BALB/c mice infected with 10 metacercana of F hepatica Titrations were
performed on days 7, 10,14 and 21
All tests were performed in triplicate
52
3 13 1 3 Pathology of liver tissue of mice infected with metacercariae of F
hepatica
A summary of the pathology observed in the liver is descnbed in Table 2 1
Tracts were observed in all infected mice at each time point, with the number of
tracts increasing as the course of infection progressed Multiple tracts were
observed m the livers of mice sacrificed at days 14 and 21 As expected no tracts
were observed m control mice Neutrophils were present in each of the infected
mice at each time point with dense aggregations observed on day 14 and day 21
(Fig
3 6 (A))
In contrast no neutrophils were recorded m control mice
Mononuclear cells were present in tracts of infected mice on day 7, and were
present m surrounding tissue at later time points, but were not observed in the
tracts Mononuclear cells were observed m the livers of all control animals
Damaged hepatocytes were observed in livers at all time points (Figs 3 4 (D),
3 5, (A), and 3 6 (B)) however no hepatocytes were observed in the tracts after day
14
As expected no damaged hepatocytes were observed m non-infected mice
No eosinophils were observed in the livers of infected or control mice
53
Table 3 1 Liver pathology recorded in mice infected with 10 metacercana of F
hepaiica. Liver tissue was isolated on days 7,10,14 and 21
Tracts
Infected
Control
Tracts were observed in all
Normal
samples at each time point
observed in all samples
Multiple
tracts
architecture
was
were
observed on day 14 and day
21
Neutrophils
Observed m all samples at
each
time
point
None observed
Dense
aggregations were noted on
day 14 and day 21
Mononuclear cells
Observed
in
100%,
of
animals on day 7 with cells
Observed
in
all
control
animals
not observed in tracts after
this time point but could be
observed
m
surrounding
tissue
Hepatocytes
Damaged
hepatocytes
None observed
observed in 60% and 50%
of animals on day 7 and day
10
respectively
Were
absent at later time points
Eosinophils
None observed
None observed
54
A.
(H & E ) (X 200)
B ar 50(xm
B.
(H & E ) (X 600)
B ar 50nm
(H & E) (X 200)
B ar 50)xm
c.
(H & E ) (X 40)
B ar 50nm
(H & E) (X 200)
B ar 50nm
E.
F ig. 3.4 L iv e r p a th o lo g y d a y 7 p o st in fe c tio n .
5S
Fig 3 4 Liver pathology day 7 post infection P hotom icrograph rep resen tin g a
section o f liver from B A L B /c m ice 7 days p o st infection w ith 10 m eta ce rc an a e o f F
hepatica
P ho to m icro g rap h illustrates (A ) a m igrating parasite, (B ) a section o f the F
hepatica adjacent to an aggregation o f degenerating neutrophils, (C ) a parasitic tract,
(D) three parasitic tracts w ithin the parenchym a, (E ) a region o f acute coagulative
necrosis o f hepatocytes
56
A.
(H & E ) (X 200)
Bar 50|im
(H & E ) (X 200)
B ar 50|im
B.
C.
Ä -«r ^
*•
.> j»
^
(H & E ) (X 600)
Fig. 3.5 Day 10 post infection.
57
Fig. 3.5 Day 10 post infection.
P ho to m icro g rap h rep resen tin g a section o f liver from B A L B /c m ice 10 days post
infection w ith 10 m eta ce rc an a e o f F hepatica
P h o tom icrograph illustrates (A) a
region o f acute coagulative necrosis o f hepatocytes This region is bordered b y a
neutrophil-rich in flam m atory cell infiltration, (B) a parasite in a tract surrounded b y a
large n u m b er o f neutrophils,
(C ) a region o f acute coagulative necrosis o f
hepatocytes in w h ich there are infiltrations o f degenerating hepatocytes
58
A.
(H & E) (X 100)
Bar 50|im
F ig. 3.6: P hotom icrograph representing a section o f liver from B A L B /c m ice
14 days post infection with 10 m etacercaria o f F. hepatica.
Photom icrograph
illustrates (A ) a parasitic tract containing neutrophils, fibrin and som e red blood
cells. A t the periphery o f this tract neutrophil-rich infiltrates are noted in the
sinuses.
A.
(H & E ) ( X I 00)
B.
B a r5 0 n m
¡MraHoi
r4
(H & E ) (X 40)
Bar 50nm
(H & E) (X 200)
Bar 50nm
C.
Fig. 3.7 Day 14 & 21 post infection.
60
F ig 3 7
P ho to m icro g rap h representing a section o f liver from B A L B /c m ice 21
days p o st infection w ith 10 m eta ce rc an a e o f F
hepatica
P h otom icrograph
illustrates (A ) a parasitic tract w h ic h is bordered b y a region o f acute coagulative
necrosis o f hepatocytes (B) illustrates m assive and bridging coagulative necrosis
(C ) illustrates extensive acute coagulative necrosis o f hepatocytes Sm all regions
adjacent b lo od vessels o f the periportal regions are spared
61
3 13 1 4 Early cytokine profile in BALB/c mice infected with F hepatica
m R N A pro d u ctio n in the m esenteric lym ph nodes show ed a do m in an t IL-4
response as early as day 1 post infection, w ith strong responses also observed on
days 4 and 8 (Fig
3 7) N o significant IFN -y specific m R N A w as observed,
although faint bands w ere visible on days 4 and 8 N o significant levels o f IL -4 or
IFN -y m R N A w ere observed at any tim e p o in t in the non-infected anim als T he
experim ent w as repeated th n c e w ith sim ilar results in each case
A dom inant IL -4 response w as observed in the hepatic lym ph nodes on day 2
p ost infection, w ith sim ilar bands observed on days 4 and 8 (Fig 3 8) N o IFN-y
m R N A w as observed at any tim e po in t N o significant levels o f IL -4 or IFN-y
m R N A w ere observed at any tim e p oint in the non-infected anim als
production in spleen cells o f F
mRNA
hepatica infected m ice w as also investigated
H ow ever, as control levels o f m R N A production w as sim ilar to that o f m R N A
representing IL -4 and IFN -y the data could not be presented w ith this experim ental
data
A lso,
as
system ic
infections
influence cytokine
p roduction
in the
com partm ent o f the spleen, and therefore m ay not represent cytokine p roduction
as a direct resu lt o f F asciola infection, the data w as not relevant to this study
The experim ent w as repeated th n c e w ith sim ilar results in each case
62
Day
0
1
2
4
8
p-Actin
Interferon-y
IL-4
Fig 3.7. E xpression o f m R N A in the m esenteric lym ph nodes obtained from
B A L B /c m ice infected w ith 10 m etacercariae o f F hepatica Lym ph node cells
w ere isolated on days 0, 1, 2, 4 and 8 post infection E xperim ents w ere repeated
thrice and the figure represents the m R N A expression per tim e point
Day
F ig 3 8 E xpression o f m R N A in the hepatic lym ph nodes obtained from BA LB /c
m ice infected w ith 10 m etacercariae o f F hepcitica L ym ph node cells w ere isolated
on days 0, 1 , 2 , 4 and 8 o f infection E xperim ents w ere repeated thrice w ith sim ilar
results in each case
3 14
Discussion
Fasciolosis is associated w ith the induction o f T -cell responses po larised tow ards
the Th2 subset
P revious studies (O ’N eill et a l , 1999), dem onstrated a dom inant
type 2 im m une response in B A L B /c m ice as a result o f infection w ith F hepatica,
w ith hig h levels o f the type 2 cytokine, IL-4, and undetectable IFN -y production
by spleen cells Studies in sheep (C hauvin et a l , 1995) and cattle (B row n et a l ,
1994) in w h ich anim als w ere exposed to infection F hepatica also describe a type
2 response C orrelating w ith previous data, results from the present study defines a
polarised type 2 im m une response as a result o f Fasciola infection Type 1 and
type 2 im m une responses counter-regulate one another through the action o f
specific cytokines (S her & C offm an, 1992), and in the context o f this experim ent,
type 1 im m une responses, m easured b y quantification o f IFN -y production, w ere
not observed at any tim e p oint investigated
S ignificant levels o f IL -4 w ere
recorded in the spleens o f m ice infected w ith m etacercan ae o f F hepatica , as
early as day 7 p o st infection
Increased levels o f IL -4 w ere recorded as infection
progressed, w ith the greatest IL -4 response recorded on day 21 p o st infection
Spleen cells w ere stim ulated in vitro w ith (1 jig/m l and 5 jig/m l) ES and LFH
B oth stim ulating antigens produced sim ilar levels o f IL-4, w ith the greatest
cytokine pro d u ctio n observed as a result o f stim ulation w ith the greater antigen
concentration
point
N o significant levels o f IFN -y p roduction w as observed at any tim e
S im ilar suppressive effects on T cell proliferation have b een observed in
infected sheep (Z im m erm an et a l , 1983 and rats (P oitou et a l , 1992)
Studies
investigating cytokine p roduction m F hepatica infected rats b y T lib a et a l ,
(2002), describe a m ix ed response at day 7, w ith increased levels o f bo th IFN-y
65
and IL -4 cytokines observed
H ow ever, b y day 14, IL -4 levels w ere m ore
pronounced w hile no IFN -y p roduction w as observed
A n tibody responses to F
hepatica illustrate a m arked p red o m in an ce o f
Ig G l (type 2) ov er Ig G 2 a (type 1) isotypes (C lery et a l , 1996)
A degree o f
protection has been associated w ith IgG 2 antibodies (M ulcahy et a l , 1998),
how ever this p rotective response is dow n-regulated in the polarised T h2 response
ch aracteristic o f in fection w ith F hepatica
In conjunction w ith the polarised type
2 cytokine response observed in the current study, antibody p rofiles o f serum
sam ples obtained from F hepatica infected m ice exhibited a p redom inant type 2,
Ig G l response W hile a significant level o f Ig G l w as not recorded at day 7, Ig G l
antibody w as observed o n days, 10, 14 and 21
P ro d u ctio n o f the ty p e 1 antibody,
IgG 2a w as not observed at any tim e p oint under investigation Studies b y C lery et
a l , (1996), also show ed Ig G l to be the dom inant im m unoglobulin isotype in cattle
infected w ith F hepatica T hese observations indicate that F hepatica actively
inhibits a type 1 im m une response
R egulation o f im m unoglobulin subclasses by
antigen specific h elp er T -cells w as observed m studies b y P urkerson & Isakson
(1992)
Studies investigating helm in th infections such as, S chistosom iasis
(C aulada-B eneditti et a l , 1998) observed that IL-4 is associated w ith secretion o f
Ig G l w hereas IFN -y is associated w ith secretion o f IgG 2a In accordance w ith
these results, w e observed that all m ice observed eliciting a pred o m in an t type 2
cytokine profile also exhibited anti-fluke Ig G l antibodies in their serum
D uring the m ig rato ry p erio d o f infection, b o th natural (sheep, cattle), and
e x p en m en tal (m ice) h osts develop a cellu lar response against the parasite
T he
m ost sin k in g feature o f tissue architecture m liver tissue, obtain ed from infected
anim als, is the occurrence o f m igratory tracts
In a study investigating liver
66
p athology as a resu lt o f infection w ith F hepatica in goats, M artinez-M oreno et
a l , (1999), recorded tracts m the hepatic surface and p aren ch y m a
In the present
study, tracts w ere observed at each tim e point, w ith m ultiple tracts observed as
infection progressed T racts are the result o f coagulative necrosis follow ed b y the
dissolution o f h ep atocytes
In som e o f the liver tissue obtained from F hepatica
infected m ice, p arasites w ere visible in the lum ina o f tracts
N eu trophils have b een suggested to p lay a role in the im m une process or in
tissue repair (M eeusen e t a l , 1995)
D uring acute prim ary infections in sheep,
neutrophils have b een observed infiltrating to the tracts produced b y the m igrating
flukes M artm ez-M oreno et a l , (1999) also observed neutrophils m the tracts o f
m igrating p arasites m infected goats L loyd and O ppenheim , (1992) observed that
neutrophils release
a range
o f im m unom odulatory cytokines
and
can
aid
significantly in the initiation and am plification o f cellular and hum oral im m une
responses
In the p resen t study n eutro phils w ere found m th e liver paren ch y m a at
all tim e points A t day 7, acute inflam m atory cells, m ain ly neutrophils, w ere
observed both in the lum m a o f tracts, on the p eriphery and w ithin adjacent sinuses
B y day 10, neu tro p h il-rich aggregations w ere also noted, usually adjacent or
encom passing v ascu lar structures
at days 14 and 21
D ense neutrophil aggregations w ere observed
Jefferies et a l , (1996) observed neutrophils surrounding or
invading hepatocytes th at appeared either still norm al or had becom e non-viable
I f cell death is due to the surrounding neutrophils, then neutrophil pro liferatio n in
the current study m ay b e responsible for som e o f the p athology associated w ith the
disease, p articu larly at the later tim e points, w here dense aggregations o f
neutrophils and increased liver dam age are observed
A lso, m this context, the
67
dense ag g regation o f neutrophils observed at days 14 and 21 p o st infection m ay
explain the lack o f dam aged hepatocytes in the tracts o f m igrating flukes
E o sin o p h ih a is defined as an increase m the n u m b er o f eosinophils m the
blood or tissues and has h istorically been recognised as a distinctive feature o f
h elm inth infections m m am m als (B ehm & O vm gton, 2000) B lo o d and tissue
eo sin o p h ih a are generally associated w ith helm inth infection D u n n g helm inth
infections eosinophils are released m ore rapidly from the bone m arrow , their
survival in tissue is enhanced, and the rate o f entry o f eosinophils into infected and
inflam ed tissues is considerably upregulated, this results m tissue eo sin o p h ih a
E vidence that eosinophils are capable o f killing m any different species o f
m etazoan
p arasites,
including
Schistosom a
m ansom
by
an
antibody
or
com plem ent dependant m echanism , suggests a role for eosinophils in defence
against these organism s T he hypothesis that the prim ary function o f eosinophils is
to p rotect the host from infection b y relatively large organism s, such as parasitic
helm inths is b ased on the accum ulation o f observations that (l) eosinophils
degranulate and kill h elm in th s in vivo (1 1 ) th ey aggregate in the vicinity o f
helm inths in vivo (ill) they are observed to degranulate in the v icinity of, or on the
surface o f helm inths in vivo (B utterw orth, 1984)
T he type 2 im m une response cytokine, IL-5 plays a key role in the
developm ent and m atu ratio n o f the eosinophil p o p ulation (B ehm & O vm gton,
2000) IL-5 controls or influences the developm ent, m atu ratio n and survival o f
eosinophils d uring a T h2 cytokine response H o w ev er direct evidence o f a role for
eosinophils m h o st pro tectio n against helm inths in vivo is lacking
Studies in
w h ich IL-5 cy to k in e pro d u ctio n w as inhibited, reduced the dev elo p m en t o f
eosinophils in response to h elm inth infection, bu t had little affect on the survival
68
or reproduction o f a n u m b er o f nem atodes and trem atodes
Studies b y P iedrafita
et a l , (2000), w ere unable to dem onstrate irreversible dam age to ju v e n ile F
hepatica flukes b y eosinophils
T hese results suggest that either eo sin o p ih c attack
is an ineffective m eans o f com bating helm inth infection, or that h elm in th s possess
the ability to evade or inhibit eosinophilic attack
O ne h ypothesis to account for the different im m une responses to eosinophilia
is that helm inths w ith rapid transit through host tissues do no t usually encounter
large populations o f activated eosinophils, as it m ay take the host seven days or
m ore p ost in fection to m ount an eosm ophilopoietic response
T herefore, rapidly
m igrating p arasites w ou ld no t h av e b een u nder evolutionary pressure to develop
protective m echanism s against attack from eosinophils, as a result o f the speed o f
m igration
F o r exam ple w hen larvae o f rapid tran sit p arasites such as
N ippostrongylus brasihensis encounter large populations o f eosinophils w ithm
hours o f in o culation into IL-5 transgenic m ice, they have inadequate protective
m echanism s and are dam aged or killed
I f the “rapid tran sit” theory is true, one
p rediction w ou ld be th at helm inths that reside in the host tissue for longer periods,
such as F
hep a tica , w ould be the ones selected during evolution to express
protective m echanism s that allow them to survive eosinophilic attack, and thus
w ould no t be adversely affected b y h y p ereosinophihc m ice
O ne such protective
m echanism against eosinophilic attack is dem onstrated b y F
hepatica derived
cystem e proteases, w h ich have been o bserved to cleave im m unoglobulins in vitro,
and inhibit the in vitro adherence o f eosinophils to ju v en ile flukes m the presence
o f im m une serum (C arm ona et a l , 1993)
suggested
th at
h elm in th s
m ay
em ploy
Studies b y C ully e t a l ,
m echanism s
recruitm ent, to p rolong survival m the host
to
inhibit
(2000),
eosinophil
E otaxin is a poten t eosinophil
69
chem o attract ant, w h ich acts through the receptor C C R 3, expressed on eosinophils
(Sallusto et a l , 2001), and is involved in the stim ulation o f eosinophils from bone
m arrow , m ediating their selective recruitm ent at sites o f in flam m atio n (U gucciom
et a l , 1997)
C ulley et a l ,
(2000), suggested an im m uno-evasive strategy
em ployed b y helm inths, in w hich p roduction o f enzym es inactivate eotaxin
prevents recru itm en t and activation o f eosinophils at the site o f infection
Inhibition o f eosinophilic responses w ere also observed m m u n n e studies b y L im a
et a l , (2002), in w hich m ice im m unised w ith h elm inth w orm extract had a
p rofound inhibitory effect on eotaxm production, resulting in reduction o f
eosinophil num bers
Studies by C arm ona et a l , (1993) dem onstrated that
cathepsm L I contained in E S products cleaved Ig at the hinge region and could
prevent the antibody m ediated attachm ent o f eosinophils to ju v e n ile flukes
In the present study, e o sm o p h ih a w as not observed m the com partm ent o f the
liver o f F
hepatica infected B A L B /c m ice
M ice w ere infected w ith 10
m eta ce rc an a e o f F h e p a tic a , and liver sam ples w ere investigated 7, 10, 14 and 21
days p o st infection E o sm o p h ih a w as not observed at any tim e p o in t in the liver
tissue, in either control or infected anim als T his observation coincides w ith the
“rapid tran sit” theory, in so far as F hepatica resides m h o st tissue for relatively
extensive periods o f tim e, and as a result m ay have developed a m eth o d o f
surviving eosinophilic attack
A nother explanation as to the lack o f eosinophils in the livers o f F asciolam fected m ice is that the parasitic tracts are the result o f coagalative necrosis
follow ed b y the d isolution o f hepatocytes
A s this is prim arily a necrotic reaction,
it has the p o tential to draw neutrophils to the site as the first cell pop u latio n
70
T herefore the local reactio n observed is possibly not driven b y a system ic
response to p arasites bu t by the p a ra site ’s ability to cause hep ato cy te necrosis
W e also studied the early developm ent o f the cellular response w ith respect
to type 1 and type 2 cytokine m R N A levels
E arly cytokine pro d u ctio n w as
m easured m the hepatic lym ph nodes (H LN ) and m esenteric lym ph nodes (M L N )
o f B A L B /c m ice d uring the first 8 days o f experim ental infection w ith F hepatica
T his study w as perfo rm ed w ith the aim o f determ ining at w hat tim e p o in t the
im m une response b ecom es p redisposed tow ards a type 2 im m une response
A lso,
the early im m une responses are the m ost likely to p ro v id e insight, and to
determ ine the outcom e o f the im m une response initiated locally to the area
contaim ng the parasite
A s the E L IS A m ethod for analysing cytokine p roduction w as not
sufficiently sensitive to m easure cytokine pro d u ctio n m this early infection tim ecourse, w e assessed cytokine p ro duction by reverse tra n scn p tio n -p o ly m erase
chain reaction (rtPC R )
W e investigated the levels o f m R N A for cytokine m arkers
in the H L N and M L N , at 0, 1, 2, 4 and 8 days post infection P relim inary tests
w ere e a rn e d out on early cytokm e p roduction in spleens o f m ice e x p en m en tally
infected w ith F hepatica (data not show n) H ow ever, as the im m une responses
observed m the spleen m ay not be specific, m the context o f F asciola infection,
and m ay rep resen t o ther peripheral im m une responses, results w ere disregarded
A p o la n se d type 2 response w as observed m the H L N as early as 2 days
post in fection w ith elevated levels o f the m R N A encoding IL -4 observed at 2 days
post infection, w ith levels rem aining constant throughout the study
m R N A encoding IFN -y w as observed at any tim e po in t
N o detectable
A p red o m in an t type 2
response m the M L N w as detected at 1 day p o st infection w ith sim ilar elevated
71
levels recorded on days 4 and 8 post infection
N o significant levels o f IFN -y
w ere present at any tim e point, although m in o r levels w ere observed at days 4 and
8 post infection R esults from the current study, consistent w ith the data from the
previous experim ent, illustrate a polarised type 2 im m une response as a resu lt o f
infection w ith F hepatica The induction o f a type 1 response appears to be dow nregulated as early as 1-2 days post infection
It appears logical th at a polarised
type 2 response w as observed m the M L N 1 day p rio r to detection in the H L N , as
the m ig rato ry p ath o f the fluke involves the fluke entering the intestine, and
therefore stim ulating a response m the local M L N , before m ig ratin g tow ards the
hepatic tissue, and the subsequent stim ulation o f the H L N
A study in rats by
T liba et a l , (2002) described significant levels o f IL -4 and IFN -y m the H L N at 4
days post infection, w h ich rem ained constant throughout the 14 day infection
R esults presented m this study provide the first evidence that the im m une
response to in fection w ith F hepatica becom e po larised tow ards th e type 2 subtype as early as 1 day p o st infection
O nce initiated, the p roduction o f the type 2
cytokine, IL -4 acts as a poten t stim ulus o f T h2 responses (A llen & M acD onald,
1998), and p ro g ressio n tow ards a type 2 im m une response is induced
IL-4
production is also believed to p lay a crucial role m the d ow n-regulation o f IFN-y,
and therefore in the inhibition m a type 1 im m une response (B rady et a l , 1999)
T his resu lt is consistent w ith studies b y O ’N eill et a l , (2000) m w h ic h the
im portance
o f IL -4 in driving the polarised type 2 im m une
response
is
dem onstrated in IL -4 deficient m ice IL -4 deficient m ice exposed to F hepatica
produce significantly h igher levels o f IFN-y, w hile the type 2 cytokines, IL-5 and
IL -10 are dow nregulated, suggesting that the polarisation o f the im m une response
72
tow ards the type 2 sub-set in fascioliasis, is dependant on IL -4 (O ’N eill e t a l,
2000)
In this study w e dem onstrated that infection w ith F hepatica induces a pre
dom inant type 2 im m une response as early as 1 day p o st infection, and therefore
provides a m odel for studying type 2 im m une responses
O ther helm inthic
infections, such as schistosom iasis, also induce a pre dom inant type 2 response,
but only at later stages o f infection w hen eggs are produced (B aulada-B enedetti et
a l , 1991)
S her et a l , (1991), d escn b e eggs as the m ajor stim ulus o f the strong
type 2 cytokine pro d u ctio n in response to infection w ith Schistosom a m ansom
F ilariasis also induces a p re dom inant type 2 im m une response, bu t elem ents o f a
type 1 responses are also observed
T herefore, w ith the early p o larisation tow ards
type 2 im m une responses, and the significant levels o f type 2 cytokines recorded,
infection w ith F hepatica provides an ideal m odel for the study o f type 2 im m une
responses
O ther benefits o f this m odel include a) laboratory rodents are relatively
inexpensive, b) can be easily infected and c) m any reagents are available for
exam ination o f im m unological responses m these hosts
W hile data derived from these experim ents have dem onstrated a polarised
type 2 response as a resu lt o f infection w ith F hep a tica , the nex t logical step is to
determ ine the source o f the type 2 im m une response T he follow ing experim ents,
investigate im m une responses to elem ents o f antigens derived from F hepatica
73
3.2
Comparison of immune responses to F. hepatica
and that of F. hepatica excretory/secretory (ES)
products.
74
Introduction
3 .2 1
Several investigators (Jeffen es et al, 1997, M ilb o u m e & H ow ell, 1997,
O ’N eill
et a l ,
2001)
have
dem onstrated
the
lm m nogem city
o f F ascio la
excretory/secretory pro d u cts (ES) Previous studies perform ed in our laboratory by
O ’N eill et a l (2001), dem onstrated that F hepatica d e n v e d (E S) p ro d u cts w ere
capable o f m im ick in g the suppressive effect o f infection w ith F hepatica on type
1 im m une responses, b y the pro d u ctio n o f a type 2 cytokine repertoire A lso, ES
products have b e e n show n to induce eo sin o p h ih a in m ice and rats (M ilb o u m e &
H ow el, 1997)
In this ex p e n m e n t w e com pared im m une responses o f F hepatica infected
m ice to that o f m ice im m unised w ith F hepatica excretory secretory products
O ur results show that bo th m ice infected w ith F hep a tica , and m ice im m unised
w ith ES, induce a po larised type 2 im m une response
W e also investigated
cellular pro liferatio n o f m ice injected w ith F hepatica d e n v e d ES
Significant
increases m pro liferatio n o f neutrophils, eosinophils and m onocytes w ere observed
in anim als injected w ith ES
Experimental design
3 2 2
E x p en m en tal groups w ere established to com pare im m une responses
b etw een F hepatica infected m ice and th at o f m ice im m unised w ith ES
F our
B A L B /c m ice aged 8-10 w eeks w ere infected w ith 10 m eta ce rc an a e o f F
hep a tica , and a further 4 m ice w ere im m unised w ith E S
non-infected m ice w as established
d islocation 14 days post-in fectio n
A control group o f 4
A ll anim als w ere sa cn fice d by cervical
Spleens w ere rem oved and cu ltured in vitro
75
w ith ES and PM A /antiC D 3
C ytokine p roduction in the supernatants w as
quantified b y E L IS A (Fig 3 9)
In tra -p e n to n e a l cellu lar profiles in response to injection w ith F
hepatica
excretory/secretory (ES) products w as exam ined m a group o f four m ice, each
receiving ES (1 0 0 |ig )
also used
A control group o f four non-infected (control) m ice w as
A ll m ice w ere sacrificed b y cervical dislocation 24 hours after
adm inistration o f ES
P eritoneal lavages w ere perform ed on each m o u se by
flushing ou t the p eritoneal cavity w ith lO m ls o f sterile phosphate b u ffered saline
C ells sam ples o f lOOjil w ere p laced on a glass slide and spun on a cytospin C ells
w ere counted as d e sc n b e d in section 2 6
Results
3 2 3 1 Comparison of IL-4 and interferon-y cytokine production by spleen
cells of BALB/c mice infected with 10 metacercanae of Fasciola, and that of
mice immunised with ES
T he greatest levels o f IL -4 cytokine w as observed in m ice im m unised w ith ES
(Fig 3 9)
Infected anim als also produced significant levels o f IL -4 N o IFN-y
response w as observed in either the infected or im m unised m ice S tim ulation o f
spleen cells w ith P M A and anti-C D 3 dem onstrated th at all cells w ere capable o f
p roducing bo th IL -4 and IFN -y cytokines
N eith er IL -4 nor IFN -y p ro d u ctio n w as
recorded m n on-m fected/im m um sed m ice
R esults w ere the m ean o f four
individual m ice for triplicate cultures o f spleen cells
76
2000 n
T
IL-4 pg/ml
1500
1000
500
0
Infected
Immunised
Fig 3 9
77
F ig 3 9
C o m p a n so n o f IL -4 and IFN -y pro d u ctio n in spleen cells o f B A L B /c
m ice infected w ith 10 F hepatica m etacercana, and that o f m ice im m unised w ith
F
hepatica
derived ES
C ells w ere isolated
14 days p o st infection or
im m unisation and stim ulated in vitro at 37°C for 72 hours w ith 5jng/ml ES
products and P M A /antiC D 3 T ests w ere e a rn e d out m tn p h c a te
78
3 2 3 2 Intra-peritoneal cellular profiles in response to administeration of F
hepatica excretory/secretory products
C ell counts show lym phocyte, m onocyte, m ast-cell, eosinphil and neutrophil
pro liferatio n as a percen tag e o f all cells recorded (Fig 3 10)
T he total n u m b er o f
peritoneal exudate cells counted m infected m ice after 72 hours w as alm ost tw ice
that recorded m control anim als T he total num ber o f peritoneal exudate cells in
control anim als w as 3 5 x 106, com pared to 6 0 x 106 in infected anim als
This
result dem onstrates that ES is instrum ental m the change in cellular profiles
observed in F a sciola infections
B etw een 80% and 95% o f cells observed w ere
lym phocytes, w ith sim ilar levels o f p roliferation observed in control and infected
m ice, although a h ig h er percentage w as observed in control m ice
S ignificantly
hig h er levels o f m onocytes w ere observed in infected m ice than in controls
(P>0 0001)
E osinophil profiles w ere significantly greater in infected than in
control m ice (P> 0 0001)
L evels o f neutrophils w ere significantly greater in
infected m ice th an control am m als (P>0 00001)
N o m ast cells w ere observed in
either control or infected m ice
79
100
90
*
80
=>0 05
** =>0 01
*** =>0 001
**** =>0 00001
70
60
50
■ Infected
□ Control
40
30
20
10
0
Lymphocytes
■
Monocytes
■
Mast cells
Eosinophils
Neutrophils
Fig 3 10 Percentage o f cells present in peritoneal lavage sam ple from B A L B /c
m ice im m unised w ith F hepaiica excretory/secretory product (100|j.g) C ontrol
m ice received PB S S am ples w ere obtained 72 hours post in fection
SO
N eu tro p h il
M o n o c y te
L y m p h o c y te
Fig. 3.11: Intra-peritoneal cellular proliferation o f B A L B /c m ouse infected w ith
lOOjug F .hepatica excretory/secretory product. C ells w ere isolated 72 hours post
infection. T ests w ere carried out thrice w ith sim ilar results in each case. (H & E)
L y m p h o c y te
F ig. 3.12: Intra-peritoneal cellular proliferation o f non-infected (control) m ouse.
C ells w ere isolated 24 hours post infection. T ests w ere carried out thrice w ith sim ilar
results in each case. (H & E)
81
3.2 4 Discussion
F asciola excretory/secretory (E S) products are believed to b e involved in several
aspects o f tissu e p enetration, im m une evasion and pathogenesis (D alton &
H effem an, 1989), and m an y studies have investigated the im m unom odulatory role
o f ES products in parasitic infections (F ukum oto et a l , 1997) A dditionally, ES
has b een observed to inhibit superoxide output in hum an n eutrophils (Jefferies et
a l , 1997) T herefore, w e w ou ld expect ES products to be involved m the
stim ulation o f the h o s ts ’ im m une response
In light o f experim ents perform ed by
M ilb o u m e and H ow ell (1997), in w hich ES products w ere suggested to induce
eosinophiha, it has been suggested that ES antigens are the m am source o f
im m une stim ulatory m aterial m the host
D ata from the prev io u s studies
dem onstrated that a type-2 im m une response is observed in response to infection
w ith F hepatica
In this study w e sought to investigate the im m une response
induced by antigens excreted and secreted by the parasite, and to com pare any
resulting response to that induced b y infection w ith F hepatica W ith this m m ind,
B A L B /c m ice w ere injected w ith ES antigens, and the resulting im m une response
com pared to that o f m ice infected w ith m etacercariae o f F hepatica
A s in the previous experim ents, a polarised type 2 im m une response w as
observed m infected m ice
C ytokine production w as m onitored 14 days post
infection, w ith significant levels o f IL -4 p roduction recorded in all infected m ice
B A L B /c m ice im m unised w ith ES also produced a p o la n se d type-2 im m une
response, w ith elevated levels o f IL -4 observed 14 days p o st im m u n isatio n w ith
ES
S ignificantly m ore IL -4 pro d u ctio n w as observed m m ice im m unised w ith ES
th an th at o f infected m ice
N o IFN -y cytokine p roduction w as detected m either
infected or im m unised m ice N o significant levels o f IL -4 or IFN -y w ere recorded
82
in control m ice O ’N eill et a l , (2001), dem onstrated that the suppression o f a type
1 im m une response b y F
parasite
hepatica is m ediated b y m olecules liberated b y the
The data presented in this study show that F
hepatica infection
stim ulates a type 2 im m une response and that ES antigens can act in a sim ilar
m an n er
T herefore, it m ay be deduced that the type 2 response observed m
fasciohasis m ay no t be as a direct result o f the p resence o f the parasite, but m ay be
stim ulated b y antigens secreted or excreted b y the invading fluke
The effects o f F hepatica excretory/secretory products on cellu lar profiles
in the p e n to n e a l cavity w ere also investigated
Studies b y M eeuseen, et a l ,
(1995) and Je ffe n es, et a l , (1996) dem onstrated that d u n n g acute infections in
sheep, neutrophils infiltrate into the prim ary tracts produced b y the m igrating
fluke, suggesting that neutrophils m ay be involved in the im m une response to
infection
T hese observations are supported b y those o f L loyd and O ppenheim ,
(1992), w ho also im plicated neutrophils in an im m uno-responsive role to F
hepatica in fection
In the present study a significantly greater n u m b er o f
neutrophils w ere recorded m m ice injected w ith ES than that o f control m ice
In
infected m ice, 21% o f total cells counted w ere neutrophils, com pared to 4% in
n on-im m unsed
control
m ice,
indicating
an
u p -reg u latio n
of
neutrophil
proliferation in response to F asciola infection or a m igration o f neutrophils to the
site o f infection
Several studies have dem onstrated th at F hepatica can have a suppressive
effect on the im m une system o f the host in w hich they reside (C hauvm , et a l ,
1995)
It has also been observed that lym phocyte populations m ay be affected by
infection w ith F hepatica (B rady, et a l , 1999) W ork b y Je ffe n es et a l , (1996)
observed th at ES products decreased lym phocyte p roliferation in sheep and hum an
83
cells
In th e p resen t study, lym phocytes w ere the m ost num erous cell type
observed in bo th control and im m unised anim als H ow ever, significantly few er
lym phocytes w ere recorded in E S -im m nuised m ice than in the n o n-im m um sed
controls thus im plying a dow n-regulation o f lym phocyte p ro liferatio n in m ice
im m unised w ith ES products
A s described in section (3 1) eo sin o p h h a is generally associated w ith
h elm inth in fection A lthough, eosinophils w ere no t observed in the com partm ent
o f the liver in our studies, significant increases in the n u m b er o f eosinophils
observed as a resu lt o f im m unisation w ith ES w ere detected in the peritoneal
cavity
W hile no eosinophils w ere detected in the p e n to n e a l cavity o f non-
im m unised m ice, 8% o f the total cells counted in m ice im m unised w ith ES w ere
eosinophils
T his observation is m contrast to observations in the previous
section, in w hich no eosinophils w ere observed m the com partm ent o f the liver m
m ice infected w ith m eta ce rc an a o f F hepatica T he occurrence o f eosinophils in
the p e n to n e a l cavity, m response to injection w ith ES, indicates a difference in the
local and system ic im m une response
S ignificantly greater num bers o f m onocytes w ere observed m the p e n to n e a l
cavity o f B A L B /c m ice im m unised w ith ES than that o f control m ice
M onocytes
are the pre-cu rso r o f m acrophages, w hich m ay act to phagocytose parasites
In the current study, the im m une response as a resu lt o f im m unisation w ith
ES p ro d u cts w ere investigated
O ur data confirm s that ES induces a type-2
im m une response, sim ilar to that o f anim als infected w ith F hepatica
In the next
section, e x p e n m e n ts w ill d e sc n b e im m une responses to antigen d e n v e d from ES,
m o rder to evaluate further the im m unostim ulatory effects o f ES products
84
3.3
Immune responses to F. hepatica derived antigens.
s.
85
Introduction
3.3 1 ES contains m olecules w hich are are secreted by all stages o f liver fluke
(D alton & H effem an , 1989) and have im portant roles in facilitating parasite
m igration (tissue degration), feeding and im m unoevasion
F o r exam ple studies by
Jefferies et a l , (1997), observed ES products involved in the inhibition o f
superoxide o utput b y neutrophils
A s oxygen scavenging enzym es such as
superoxide dism utase have been suggested to have a p rotective role against
invading p arasites, inhibition o f superoxide output m ay p rovide a m eans o f
im m une evasion for an invading helm inth
A s dem onstrated m experim ents b y
M ilb o u m e & H ow ell (1997) and O ’N eill et a l , (2001), ES products are k now n to
illicit a stim ulatory effect on im m une responses, w h ich are sim ilar to im m une
responses o bserved m infection w ith F
hepatica F o r exam ple M ilb o u m e and
H ow ell (1997), recorded eosinophilia m rats as resu lt o f injection w ith ES, and
also as a result o f infection w ith F hepatica Therefore, it m ay be assum ed that
im m une responses to F a sciola infection m ay in part b e due to the p ro duction o f
ES by the invading parasite V a n o u s fractions o f ES w ere p u n fie d in order to
com pare v a n o u s com ponents o f ES m term s o f induced im m une responses, and to
investigate elem ents o f F
hepatica d e n v e d antigen w hich stim ulate type 2
im m une responses
In this study, spleen cells taken from F hepatica-m iQ ctcd B A L B /c m ice,
w ere analysed for T -cell cytokine p roduction (IL -4 & Interferon-y) in response to
stim ulation w ith v a n o u s F hepatica-d e n v e d antigen
A lso, T -cell cytokine and
antibody pro d u ctio n w as investigated m B A L B /c m ice im m unised w ith v a n o u s F
h e p a tic a -d e n v e d antigen
86
Experimental design
3 3 2 ES w as p u rified on a gel filtration colum n, and the resulting fractions w ere
isolated m term s o f m olecular w eight, p rotein concentration and cysteine p rotease
activity
ES w as separated on a Sephacryl S300, high resolution gel ultra-
filtration co lu m n “p eak 1” and “p eak 2” w ere established b y m o n itoring fractions
for p rotein concentration and cathepsin-L activity F ractions containing a high
p ro tein co n centration and no cystem e protease w ere pooled and term ed p eak 1,
w hile fractions containing cystem e protease activity w ere pooled and term ed peak
2 (Fig 3 13) F a sciola antigens are show n in F ig 3 14
To investigate the im m une response o f cells o f F hepatica infected m ice,
stim ulated w ith F hepatica d e n v e d antigen, four m ice aged 8-10 w eeks, w ere
infected w ith 10 m eta c e rc a n a o f F hepatica A control group o f four non-infected
m ice w as established
p ost infection
A ll m ice w ere sacrificed b y cervical dislocation 14 days
Spleen cells w ere stim ulated in vitro at 37°C w ith ES (10 jig/m l),
peak 1 (10 |ig /m l), and peak 2 (1 0 ^g /m l), Stim ulation o f spleen cells w ith P M A
and anti-C D 3 dem onstrated that all cells w ere capable o f p roducing b o th T h l and
Th2 cytokines
control
C ells w ere stim ulated w ith culture m edia to act as a negative
T he am ount o f IL -4 and IFN -y secreted into the culture m ed ia w as
m easured by b io -assay (Fig 3 13)
In o rder to establish the type o f im m une response to m ice im m unised w ith F
hepatica d e n v e d antigen, three groups o f four B A L B /c m ice aged 8-10 w eeks
w ere im m unised w ith ES, p eak 1, and peak 2, respectively
A control group o f
four n o n -im m u m sed m ice w as established S pleens w ere rem oved 14 days post
im m u n isatio n and stim ulated w ith (5 (ig/m l) E S, peak 1 and peak 2 C ells w ere
stim ulated w ith P M A and anti-C D 3 as a positive control and culture m ed ia as a
negative control
S upernatants w ere rem oved and the levels o f IL -4 and IFN -y
87
cytokines secreted into the culture m ed ia w as recorded b y bio -assay
R esults
show a p o la n se d T h2 (IL -4 cytokine) response m all im m unised gro u p s (Fig
3 14) N o IFN -y w as recorded m any o f the im m unised groups (F igs
3 15)
R esults w ere expressed as the m ean cytokine concentration o f four m ice p e r group
tested m triplicate
To investigate antibody p roduction in response to im m unisation w ith F
hepatica d e n v e d antigen, serum sam ples w ere analysed for Ig G l and IgG 2a
isotype p roduction from three different groups o f B A L B /c m ice follow ing m trap e n to n e a l im m unisation w ith F hepatica d e n v e d antigen
w ere im m unised w ith E S , G roup 2
(G roup 1 m ice that
m ice w h ich receiv ed p eak 1, G roup 3 m ice
im m unised w ith peak 2, and a control group o f non-im m um sed m ice)
Serum
sam ples w ere obtained 14 days p o st im m unisation A nalysis o f Ig G l and IgG 2a
antibody production w as perform ed on each m ouse
A n tibody titrations w ere
perform ed using each o f the im m unising antigen as antigen for the titrations,
including P M A /antiC D 3 and m ed ia as positive and negative controls, respectively
Fig
3 16 show s the m ean antibody levels o f each group obtained w ith serum
dilutions o f 1 25000
3 3 3 Results
Enzyme activity
Protein concentration
3 3 3 2 Purification of F hepatica derived antigen
Fraction
F ig
3 13
P u rification
profile
of
peakl
and
peak
2
from
F
excretory/secretory products on a high resolution gel-filtration co lu m n
concentration and C athepsm -L activity o f ES fractions w ere recorded
hepatica
P rotein
F ractions
containing a hig h p ro tein concentration and no cysteine protease activity (fractions,
22-43) w ere p o o led and term ed p eak 1
F ractions containing a h ig h protein
concentration and cysteine protease activity (fractions, 44-96) w ere po o led and
term ed peak 2
89
SDS PAGE analysis of the ES antigen
lk b L adder
- ± r
ES
Peak 1
1
1
Peak 2
1
Fig. 3.14: Separation o f F. hepatica derived antigen by SD S gel (15% running
gel, 5% stacking gel), show ing the m ajor proteins secreted by the parasite.
5\i\
(lO jig/m l) sam ples w ere applied w ith lOjul o f lk b m olecular m arker. The
haem oprotein is visible in peak 1, w hile a C athepsin-L band is visible in peak 2.
3 3 3 3 Antigen specific cytokine production in spleen cells of mice infected
with metacercanae of F hepatica
A pred o m in an t type 2 cytokine response w as observed in infected m ice w ith cells
stim ulated b y ES, p eak 1, and peak 2 (Fig
3 15)
C ells stim ulated w ith ES
p ro d u ced the greatest cytokine (IL -4) response N o significant levels o f IFN -y w as
detected m in fected m o u se cells stim ulated w ith F
hepatica derived antigen
Spleen cells from the non-m fected (control) m ice did not secrete either T h l (IFN y) or Th2 (IL -4) cytokines m response to stim ulation w ith F hepatica derived
antigen R esults w ere the m ean o f four m ice tested m triplicate
91
lL-4 pg/ml
□ E S 1 0 ug/m l
1 P 1 1 0 ug/m l
B P 2 1 0 ug/m l
■ PM A
Interferon gamma nq/ml
70
eo
50
□ ESIOugfrl
40
■ PI 10ugfa1
BR210lq^itI
30
■ FM\
20
10
0
A n tm en
Fig 3 15
Q?
F ig 3 1 5 IL -4 and IFN -y cytokine p roduction by spleen cells o f B A L B /c m ice
infected w ith 10 m eta ce rc an a e o f F hepatica C ells w ere isolated 14 days p ost
infection and stim ulated in vitro for 72 hours at 37°C , w ith lOjag/ml E S, lOjug/ml
peak 1, 10jug/ml peak 2, 10(ig/m l and PM A /antiC D 3
A ll tests w ere e a rn e d out
m tn p lica te
93
3.3.3.4 : Antigen-specific cytokine production in spleen cells of mice
immunised with F. hepatica derived antigen.
R esults show a p olarised type 2 (IL-4 cytokine) response in all im m unised groups
(Fig. 3.16). N o IFN -y w as recorded in any o f the im m unised groups (Fig. 3.17).
R esults are expressed as the m ean cytokine concentration o f four m ice p e r group
tested in triplicate.
94
-D
S
jt
Fig. 3.16
IL-4 pg/m
IL-4 pg/ml
N)
N)
CD oo o ro ^
o o o o o o o o
CD00
O
N)
o o o o o o o
I
■
TI
>
o
iS
□
“ü "0 ITI
ro
(7)
Ol cn
c
c
j”
(O CQ (Q
1
1
■
U S D
TJ
TI
>
Ol Ol Ol
ro
TI
m
Cf)
<9. (S <o
3 3 3
IL-4 pg/ml
IL-4 pg/ml
ro ^ cd oo o ro
o o o o o o o
■ ■ s □
■ □
“Ü “0
“0 "u "0 m
^
^
>
oi cn cn
CQ (§ (Q
co
1 3 3
□ □
“Ö m
—
*• œ
CJl CJl oí
c c c
(Q (Q (Q
3 3 3
TO
>
140
roAOJooofo^O)
o o o o o o o o o
F ig 3.16: IL -4 p ro d u ctio n in spleen cells taken from m ice im m unised w ith (A ) ES,
(B) peak 1, and (C ) peak 2. A non-im m unised control group (D ) w as established.
C ells w ere isolated 14 days post-infection and stim ulated in vitro for 72 hours at
37°C , w ith (5 |ig /m l) ES, peak 1, peak 2, PM A /antiC D 3. R esults w ere expressed
as the m ean cytokine concentration o f four m ice p er group tested in triplicate.
96
D
3
•
LS
TT
N>
?
qtq’
u>
Interferon gamma ng/ml
-X
O
ho
03
0
0
O
> 0
O
O
Interferon gamma ng/ml
0
ho
W
A
O
O O
O O
O O
O
Ti
8
□
GO
T) m
N)
- k
cn
cn cn
CQ
(Q (Q
cn
cn cn
3
3 3
CQ
(Q CQ
3
3 3
c
c c
c
c c
01
Interferon gamma ng/ml
Interferon gamma ng/m
o
o
W
U
o
o
o
o
o
O O
Oo O o
o
o
o
o
o
■
m
TI
TJ
ro
“ö
cn
c
CQ
cn
c
CQ
CO
1
3
;!
>
□
ÍTI
</>
<J1
51
o
o
1-_ J___ I
A
T)
m
^ TI TI <
J)
> C
T
O
i
O
C C dl
(O
CO
(Q
3 3 3
Fig. 3.17: IFN -y p ro d u ctio n in spleen cells taken from m ice im m unised w ith (A)
ES, (B) peak 1, and (C ) peak 2. A non-im m unised control group (D ) w as
established. C ells w ere isolated 14 days post infection and stim ulated in vitro for
72 hours at 37°C , w ith (5|ng/m l) ES, peak 1, peak 2, P M A /antiC D 3. R esults w ere
expressed as the m ean cytokine concentration o f four m ice p er group tested in
triplicate.
98
3.3.3.S IgGl and IgG2a antibody production in serum of mice immunised
with F. hepatica derived antigens
A ntibody analysis o f im m unised groups, stim ulated w ith ES (Fig. 3.17-A)
dem onstrated a pre dom inant Ig G l response to im m unisation.
M ice im m unised
w ith ES produced the highest levels o f Ig G l. A nim als im m unised w ith peak 1 and
peak 2, also produced significant levels i f I g Gl . IgG 2a p ro duction w as also
o bserved in anim als im m unised w ith ES, peak 1 and peak 2.
N o antibody
production w as recorded in control anim als.
Serum stim ulated w ith peak 1 (Fig. 3.17-B ) displayed a p olarised T h2
response in all im m unised groups.
L ow levels o f IgG 2a w as observed in m ice
im m unised w ith ES, peak 1 and peak 2. N o antibody response w as observed in
control m ice.
A nalysis o f serum sam ples stim ulated w ith peak 2 (Fig. 3.17-C ) dem onstrated
a polarised T h2 response w ith the greatest antibody pro d u ctio n observed in the
group im m unised w ith ES. L ow levels o f IgG 2a w ere observed in m ice im m unised
w ith ES and peak 2. N o antibody production w as observed in control m ice. R esults
are the m ean o f four individual m ice, tested in triplicate.
99
25000
LI
20000
15000
10000
5000
Peak 1
Peak 2
■ IgG l
□ lgG2<
Control
Im m u n is a tio n a n tig e n
25000
20000
15000
10000
5000
III
ES
Peak 1
■ lgG1
□ lgG2a
Peak 2
Control
Immunisation antigen
25000
20000
15000
10000
5000
I I
Peak 1
Peak 2
■ IgGl
□ lgG2a
Control
Immunisation antigen
Fig. 3.18
100
Fig. 3.18: (A ) Ig G l and IgG 2a antibody production w ith specificity for F. hepatica
excretory/secretory products, in serum taken from im m unised B A L B /c m ouse cells.
M ice w ere im m unised w ith excretory/secretory products, peak 1, and p eak 2. A ll
tests w ere p erform ed in triplicate. (B) Ig G l and IgG 2a antibody p ro duction w ith
specificity for p eak 1, in serum taken from im m unised B A L B /c m ouse cells. M ice
w ere im m unised w ith excretory/secretory products, p e a k l, and p eak 2.
w ere perfo rm ed in triplicate. (C ) Ig G l
A ll tests
and IgG 2a antibody p ro d u ctio n w ith
specificity for peak 2, in serum taken from im m unised B A L B /c m ouse cells. M ice
w ere im m unised w ith excretory/secretory products, peak 1, and p eak 2.
A ll tests
w ere perfo rm ed in triplicate.
101
3.3.4 : Discussion
Sections 3.1 and 3.2 described the polarised type 2 im m une response observed in
response to infection w ith F. hepatica. A lso investigated, w as the pred o m in an t type 2
response induced by im m unisation w ith F. hepatica derived ES. In the current study w e
investigated im m une responses to isolated fractions o f purified ES (peak 1 and peak 2),
in order to further investigate the source o f the type 2 im m une response.
Studies
involving various helm inth antigens including antigens contained in ES have been
perform ed by several investigators. A type 2 response w as observed in w ork b y C ervi
et al (1999) in w hich rats w ere im m unised w ith F. hepatica derived glutathione-S transferase.
M ice im m unised w ith recom binant fatty acid b inding pro tein from F.
hepatica exhibit antibody production characteristic o f type 1 im m une responses (A bane
et a l., 2000). A hig h m olecular sized antigen secreted by adult flukes into culture
m edium w as isolated by M cG onigle and D alton (1995). T his m olecule contained a
hem e group, and w as classified as a liver fluke haem o g lo b in (H b) (M cG onigle &
D alton, 1995). H b is involved in the aerobic respiration o f ju v e n ile flukes w hen present
in the liver.
In adult flukes, it aids in o x y g en -in d ep en d en t functions such as egg
p ro duction (B jorkm an & T horsell, 1963).
T his hem ep ro tein (a conjugated protein
linked to an iron-porphyrin com pound), is present in the current study contained in
peak 1. S tudies b y D alton et a l , (1996) dem onstrated that tw o cathepsin L proteinases,
cathepsin L I (C L 1), and cathepsin L2 (C L 2), w hich are contained in p eak 2, in the
context o f this experim ent, m ay be involved in host tissue penetration, nu tritio n and
im m une evasion.
B entancor et a l , (2002) observed a type 1 im m une response in rats
im m unised w ith cathepsin L I and cathepsin L2.
CL1 and C L 2 d iffer in their
specificities for hy d ro ly sin g peptide bonds (D ow d, et a l , 1994). In studies by D alton
et a l , (1996),
C athepsin L2 w as observed to cleave peptide bonds w ith greater
efficiency than th at o f cathepsin L I .
F or exam ple, cathepsin L2 cleaved several
peptide bonds w ith a pro lin e in the P-2 position that w ere p o o rly cleaved b y cathepsin
L I (D ow d et a l., 1994). T he difference in observed specificities m ay indicate that the
tw o cysteine proteases have different roles in digestion, tissue pen etratio n or im m une
evasion (D alton e t al., 1996).
In the previous experim ents, all cytokine and antibody pro d u ctio n as a result o f
F asciola infection, w as m easured w ith specificity for F. hepatica ES.
In the current
studies cytokine and antibody production stim ulated by F ascio la infection w as
m easured w ith specificity to ES and E S-derived antigen. T hese experim ents aim ed to
determ ine and com pare the im m unogenicity o f the various F asciola derived antigens.
Spleen cells obtained from F. hepatica infected B A L B /c m ice w ere stim ulated
w ith F. hepatica derived antigen. A s in our previous experim ents, high levels o f ESspecific IL -4 pro d u ctio n w ere observed in spleen cells o f infected m ice. T he ESderived peak 1 and peak 2 produced sim ilar levels o f IL-4, although p ro duction w as not
as great as that observed by E S -stim ulated spleen cells.
T he hem e p rotein contained in peak 1 m ay be in part, responsible for the
p o larisation o f the im m une response tow ards the type 2 sub-type, observed w ith
stim ulation w ith peak 1. T he type 2 response elicited by spleen cells obtained from
m ice infected w ith F. hepatica and stim ulated w ith peak 2, is in contrast to w ork by
B entancor et a l, (2002), in w hich a type 1 response w as o b served in response to
im m unisation w ith CL1 and C L 2 cysteine proteinases, present in the context o f this
experim ent, in peak 2. (Fig. 3.16).
T he type-2 im m une response observed
in the
current study m ay be as a result o f the com bination o f the tw o proteases, the im m une
response to w hich w as not investigated by B entancor, e/ a l , (2002). A lso, other
m olecules p rese n t in p eak 2, w hich are y et to b e identified, m ay b e involved in the
stim ulation o f a type 2 response.
103
T his study also investigated the im m une responses o f B A L B /c m ice to F.
hepatica derived E S, peak 1 and peak 2. A sim ilar type 2 response w as observed in
m ice im m unised w ith ES antigens to that o f F. hepatica infected m ice stim ulated w ith
ES antigens. C ytokine production w as m easured in im m unised m ice, w ith specificity
for each o f the F ascio la antigens.
p redom inant type 2 response.
E ach o f the im m unising antigens produced a
S im ilar levels o f IL-4 cytokine w ere observed in m ice
im m unised w ith ES and peak 1. L ow er, levels o f IL -4 p roduction w as recorded in m ice
im m unised w ith peak 2. S tim ulation o f im m unised m ouse spleen cells w ith each o f the
antigens had sim ilar effects on IL-4 cytokine production. A s expected, no IFN-y
p roduction w as detected in any o f the im m unisation groups.
A ntigen-specific antibody production in F. h ep a tica -d zriv ed an tigen-im m unised
m ice w as also investigated (Fig. 3.18).
A polarised type 2 antibody profile w as
observed in response to im m unisation w ith each o f the antigens. A ntigen specific Ig G l
antibody p ro duction w as recorded in each o f the im m unised groups for each o f the
stim ulating antigens.
104
3.4
Immunisation with F. hepatica-derived antigen and
various adjvuvants.
105
Introduction
3.4.1: W hile a type 2 im m une response is associated w ith F. hepatica infection, a
type 1 response has been suggested as being involved in pro tectio n against the
parasite. S tudies by M ulcahy et al., (1998) dem onstrate a p rotective function for
type 1 im m une response associated antibody isotypes (IgG 2).
T he aim o f this
experim ent w as to establish a predom inant type 1 im m une response in B A L B /c
m ice by im m unising w ith various com binations o f adjuvants and antigen (m utant
CL1).
A djuvants help antigen to elicit an early, high and long-lasting im m une
response w ith less antigen (G upta & Siber, 1995). T he adjuvants used in the
current experim ent w ere alum (alum inium hydroxide), heptavac (A C lostridium
p e rfo rin g en s vaccine) and oligodeoxynucleotides w ith cpg m otifs (unm ethyiated
C pG m otifs).
Experimental design
3.4.2: E xperim ental groups o f 4 B A L B /c m ice w ere established.
(G roup 1: m ice
that w ere im m unised w ith m u tF h e C L l and cpg; G roup 2: m ice im m unised w ith
m u tF h e C L l, alum , cpg and heptavac; G roup 3: m ice received m u tF h e C L l, alum
and cpg; G roup 4; m ice that received m u tF h e C L l, alum and heptavac; G roup 5 :
m ice im m unised w ith m u tF h e C L l
im m unised
m ice
w as
established.
and alum . A control group o f four n o n ­
A ll
im m unised
m ice
im m unisations at days 21 and 42 post initial im m unisation.
received
booster
A ll anim als w ere
sacrificed after 61 days b y cervical dislocation. Isolated spleen cells w ere stim ulated
in vitro at 37°C w ith rec F h e C L l (1 0 |ig /m l, 5(ig/m l, ljug/m l) and m u tF h eC L l
(5jig/m l, 1jig/m l).
S upernatants w ere rem oved and the am ount o f IL -4 and
interferon-y secreted into the culture m edia w as determ ined b y m eans o f EL ISA .
106
T he antibody responses to im m unisation w ere investigated 61 days p o st­
im m unisation. T he titre o f IgG subclasses w as determ ined using m u tF h e C L l and
C lostridium p e rfrin g en s as antigen in antibody titrations (Fig. 3.21-22).
3.4.3 Results
3.4.3.1: IL-4 and Inteferon-y cytokine production in mice immunised with F.
hepatica-derixed antigen and various adjuvants
The results dem onstrate that predom inant type-1 response can be induced in
spleen cells o f m ice stim ulated w ith re c F h e C L l, w ith significant am ounts o f IFN-y
cytokine b eing produced (Fig. 3.19). The greatest am ount o f IFN -y produced w as
observed
in
m ice
im m unised w ith
m u tF h e C L l,
alum ,
cpg
and heptavac.
G enerally, cells stim ulated w ith a h igher concentration o f antigen resulted in a
h igher level o f cytokine production.
pro duction w as recorded (Fig. 3.36).
N o significant level o f IL-4 cytokine
L ow levels o f IL -4 w as observed in m ice
im m unised w ith m u tF h e C L l, alum , cpg and heptavac.
interferon-y
or
IL -4
w ere
observed
in
im m unised
N o significant levels o f
m ice
stim ulated
w ith
m u tF h e C L l (Figs. 3.38 and 3.39). R esults w ere expressed as the m ean cytokine
concentration o f four m ice p er group tested in triplicate.
107
300
250
IL-4 pg/ml
200
□ recFheCLI 1ug/ml
150
H recFheCLI 5ug/ml
■ recFheCLI 10ug/ml
100
50
0
CL1 & cpg
CL1 & Alum & CL1 & Alum & CL1 & Alum &
cpg &
cpg
Heptavac
Heptavac
CL1 & Alum
Experimental group
50
45
Interferon gamma ng/ml
40
35
30
25
□ recFheCLI 1ug/ml
20
□ recFheCLI 5ug/ml
■ recFheCLI 10ug/ml
15
10
5
0
CL1 & cpg
CL1 & Alum & CL1 & Alum & CL1 & Alum &
cpg &
Heptavac
cpg
Heptavac
CL1 & Alum
Experim ental group
Fig. 3.19
108
Fig. 3.19: C yto k in e p ro duction b y spleen cells o f B A L B /c m ice im m unised w ith
various antigen and adjuvants. M ice received b o o ster im m unisations on days 21
and 42.
A ll anim als w ere sacrificed on day 61.
Spleen cells w ere isolated and
stim ulated in vitro for 72 hours at 37°C w ith 1jag/ml, 5 |ig /m l and 10jig/m l
re c F h e C L l.
S am ples o f supernatant w ere m easured for IL -4 (Fig. 3.36) and
interferon-y (Fig. 3.37) cytokines. R esults w ere expressed as the m ean cytokine
concentration. T ests w ere carried out in triplicate.
109
300
250
200
□ mutFheCLI 1 ug'rri
o>
150
□ mutFheCL.1 5ug^rrl
Q_
■ m utFheC L I10 ug/rrl
100
-
50
CL1 & cpg
CL1 & A um CL1 &Alum CL1 &AJum CL1 &Alum
& cpg&
& cpg
&Heptavac
Hsptavac
Experimental group
50
45 j
40
35
E
•—
30
□ miFheCLI 1 ug/rrl
o>
c 25
cc
E 20
E
(U
CD 15
c
0
10
1CD
5 ;
0+-
IrrutFheCLI 5 u^rri
IrrutFheCLI 10ug/ni
i
CL1 &cpg
CL1&^Jim& CL1&Alim& CL1 &Alim&
cpg&Heptavac
cpg
Heptavac
CL1 &Alim
Experimental group
Fig. 3.20.
1 10
Fig. 3.20 : IL -4 (Fig. 3.38) and Interferon-y (3.39) cytokine p ro d u ctio n in spleen
cells taken from m ice im m unised w ith various antigen and adjuvants.
M ice
received b o o ster im m unisations an days 21 and 42. A ll anim als w ere sacrificed on
day 61.
Spleen cells w ere isolated and stim ulated in vitro for 72 hours at 37°C
w ith ljiig/m l, 5|^g/m l and 10|ag/m l m u tF h e C L l.
R esults w ere expressed as the
m ean cytokine. T ests w ere carried out in triplicate.
Ill
3.4.3.2: IgGl and IgG2a antibody production in serum of immunised mice.
A p re-d o m in an t Ig G l antibody response w as observed in response to stim ulation
w ith m u tF h e C L l
(3.21).
S ignificant levels o f Ig G l
w ere observed
in all
experim ental groups w ith the exception o f m ice im m unised w ith heptavac w here
low levels o f antibody production w ere observed. T here w ere no significant
m u tF h e C L l-sp ec ific IgG 2a antibodies detected in the serum o f im m unised m ice.
N o antibody p ro d u ctio n w as observed in control n o n -im m unised m ice.
R esults
w ere expressed as the m ean antibody titration o f four m ice p er group tested in
triplicate.
In serum stim ulated w ith C. p erfo rin g en s a p redom inant I ill response w as
observed in response to im m unisation (3.22). T he highest levels o f Ig G l antibody
production w ere observed in m ice im m unised w ith (i) m u tF h e C L l, alum and
heptavac, (ii)m u tF h e C L l, alum , cpg and heptavac and (iii) cpg and heptavac. N o
antibody p ro duction w as observed in control, non-infected m ice. R esults w ere
expressed as the m ean antibody titre o f four m ice p er group tested in triplicate.
112
300000
250000
200000
UlgG1
□ lgG2a
150000
100000
50000
CL-1 & cpg
CL-1 & Alum
& cpg &
Heptavac
CL-1 & Alum CL-1 & Alum
& cpg
& Heptavac
CL-1 & Alum
& PBS
Control
Experimental group
Fig. 3.21
300000
250000
200000
v
■ igGi
□ lgG2a
150000
100000
50000
CL-1 &cpg
CL-1 &AJum& CL-1&AJum& CL-1 & Alum & CL-1&Aum&
cpg & Heptavac
cpg
Heptavac
PBS
Control
Experimental gnoip
Fig. 3.22
in
Figs. 3.21-3.22: Ig G l and IgG 2a antibody p roduction in serum taken from m ice
im m unised w ith various antigen and adjuvants. M ice w ere sacrificed 61 days post
infection and serum obtained. R esults in fig. 3.21 show antibody production
specific for F asciola m u tF h e C L l. R esults in fig. 3.22 show antibody p roduction
specific for C. p e rfo rin g en s bacteria. R esults are expressed as the m ean antibody
titre o f four m ice p er group tested in triplcate.
114
3.4.4 : Discussion
O bservations b y B erquist, et a l , (2002) in relation to im m une responses in
helm inth infections suggest that there are desirable, antigen-specific im m une
responses that w ould be valuable in a vaccine, but that there are also im m une
responses that should be avoided.
T he polarised type 2 im m une responses in
helm inthic infections, and subsequent inhibition o f type 1 im m une responses m ay
be advantageous to the parasite, as type 1 responses have been suggested to have a
p rotective role in infections such as schistosom iasis (C jaja, et a l , 1989). Studies
by C lery et al., (1996) show ed the type 2 antibody, Ig G l to b e the dom inant
isotype in F. hep a tica -infected cattle. H ow ever, this type 2 im m une m echanism
appeared to be a n on-protective response. W hile natural infections in cattle and
sheep appear to elicit non-protective type 2 im m une responses, studies by
M ulachy et al, (1998) indicate that the protection induced b y vaccination involves
elem ents o f a type 1 response. C apron and C apron (1994), suggested that T -cell
m ediated im m unity involving IFN-y and IL -12-dependant m echanism s (type 1
response) m ig h t be m ore advantageous in helm inth infections.
T his observation
is in agreem ent w ith studies by W ynn and H offm ann (2000), w hich d em onstrate
that im m unity to helm inth infections is h ighly dependant on the pro d u ctio n o f
IFN-y from C D 4+ T -cells.
A lso, Sm ythies et a l (1992) dem onstrated decreased
im m nity to helm inth infections in m ice deficient in IFN-y. A p ositive correlation
b etw een fluke-specific serum Ig G l levels and fluke burden w as recorded in w ork
b y M ulcahy et a l , (1998), w hile a strong IgG 2 (type 2) response w as associated
w ith low fluke burdens. T he results o f this study are further evidence o f the nonprotective status o f specific im m une responses in cattle follow ing infection w ith F.
115
hepatica, and dem onstrate that vaccination m ay induce a protective response
(M ulcahy et al., 1998).
S tudies b y D alton, et a l., (1996), dem onstrated that a significant degree o f
protection could be achieved in cattle against infection w ith F. hepatica, by
im m unising w ith various F. hepatica derived antigens.
C athepsin L proteases,
cathepsin L I , cathepsin L 2, secreted by liver flukes, and liver fluke haem oglobin
(H b), w ere used in conjunction w ith F reunds com plete and F reunds incom plete
adjuvants. T he initial trial dem onstrated that cattle vaccinated w ith cathepsin L I
induced 53.7% pro tectio n against a heterologous challenge w ith F. hepatica.
A
subsequent trial show ed that a com bination o f cathepsin L I and H b could also
elicit a p rotective im m une response.
The m ost significant level o f protection
(72.4% ) w as observed in anim als vaccinated w ith a com bination o f cathepsin L2
and Hb.
A nim als vaccinated in theses studies, displaying a level o f protection
against fascioliasis, exhibited an antibody profile predisposed tow ards a type 1
subset, w ith significant levels o f IgG 2 antibody recorded.
T he fact that the
im m une response o f these vaccinated anim als exhibited a polarised type 1 im m une
response m ay in part be due to the use o f Freunds adjuvants, w hich are kn o w n to
influence im m une responses in favour o f the type 1 sub type.
W ith these observations in m ind, the current study sought to establish a
type 1 im m une response in B A L B /c m ice by im m unising w ith F. hepatica derived
antigens and 2 types o f adjuvants. Investigations w ere perform ed in m ice as few er
reagents w ould b y required to perform the investigation than that required in
cattle, and also due to the lesser cost o f m ice.
A s F reunds adjuvant has been
know n to cause path o lo g y in hum ans w e investigated the p o ssib ility o f using a
different adjuvant w hich w ould still provide type 1 im m une resp o n se-in d u cin g
116
properties.
Studies by N ear et a l., 2002 observed that oligodeoxynucleotides w ith
cpg m otifs (cpg), used as an adjuvant aided in the prom otion o f a type 1 im m une
response, w ith elevated levels o f IFN -y recorded.
C p g ’s w ere em ployed in the
current study as an adjuvant.
H eptavac is com m ercially available as a vaccine against the bacterial
infection, C. P erfoingens.
P relim inary studies (data not show n) investigated the
ability o f heptavac to stim ulate a type 1 im m une response in im m unised m ice,
how ever no po larised response w as observed. H eptavac w ith a co m bination o f
other adjuvants and antigen, w as established as an adjuvant in the current study.
A lum h ydroxide w as also used as a com parative adjuvant.
A nim als w ere im m unised w ith a com bination o f various adjuvants and
re c F h e C L l. C ytokine p ro duction w as m onitored w ith specificity for tw o form s o f
cathepsin L, the active form , rec F h e C L l and inactive form , m u tF h e C L l (C ollins,
et a l in press).
IL -4 and IFN -y cytokine analysis in spleen cells o f im m unised B A L B /c
m ice, stim ulated w ith rec F h e C L l exhibited a polarised type 1 im m une response in
m ice im m unised w ith (i) CL1 and cpg, (ii) C L 1, alum , cpg and heptavac, (iii)
CL1, alum and cpg and (iv) C L 1, alum and heptavac. A s expected, low er levels o f
IFN-y w ere recorded in m ice im m unised w ith CL1 and alum .
N o significant
levels i f IL-4 w ere detected. C ytokine analysis o f im m unised m ouse spleen cells,
stim ulated w ith m u tF h e C L l failed to produce significant levels o f IL -4 or IFN-y.
T hese results dem onstrate that the inactive form o f cathepsin L, m u tF h e C L l fails
to elicit a t-cell stim ulatory effect (Fig. 3.20), w hile the active form , rec F h e C L l
induces a po larised type 1 response (Fig. 3.19) w hen em ployed in conjunction
w ith the appropriate adjuvants.
117
A ntibody
analysis
o f serum
obtained
from
im m unised
m ice
w ith
specificity for m u tF h e C L l, also exhibited a polarised type 1 im m une response
(Fig. 3.21). S ignificant levels o f IgG 2a antibody w ere detected in anim als
im m unised w ith (i) CL1 and cpg, (ii) CL1, alum , cpg and heptavac, (iii), CL1,
alum and cpg, (iv) C L 1, alum and heptavac, (v) CL1, alum and PB S.
W e also
investigated antibody p roduction w ith specificity for clostridium bacteria.
O nly
m ice im m unised w ith (i) C L 1, alum and heptavac and (ii) C L 1, alum , heptavac
and cpg, produced clostridium specific IgG 2a. H ow ever clostridium -specific
antibody pro d u ctio n w as significantly low er than that o f antibody p roduction w ith
specificity for m u tF h e C L l.
118
4.1
General Discussion
119
Discussion
4.1.1: Im m une responses to m ost helm inths elicit sim ilar responses, w hich are
characterised by the p ro duction o f type 2 associated cytokines (IL -4, IL -5, IL-9,
IL-10, IL -13), and antibodies (Ig G l in m ice, IgG 4 in hum ans and IgE in both
species).
O nce initiated type 1 and type 2 im m une responses tend to counter-
regulate one another th ro u g h the action o f the cytokines that are specific to each
type o f response. Several helm inthic antigens have b een associated w ith the
induction o f type 2 responses. C ervi et al ., (1999) observed a type 2 response in
rats
im m unised
w ith
F.
hepatica-denved g lutathione-S -transferase,
w hile
M ilb o u m e and H ow ell (1997) recorded type 2 responses in rats im m unised w ith
ES products o f F. hepatica. In contrast A bane et al ., (2000) observed an antibody
profile ch aracteristic o f type 1 im m une responses in m ice im m unised w ith
recom binant fatty acid b inding protein.
In the current study w e com pared the im m une responses o f m ice infected
w ith F. hepatica to that o f m ice im m unised w ith F. hepatica ES. R esults show
that ES is capable o f m im icking the type 2 im m une response observed in F asciola
infection, and as such, m ay be in part responsible for im m unopathology associated
w ith Fasciola infection (M ilb o u m e & H ow ell, 1997).
M ice im m unised w ith
various F. hepatica derived antigens displayed a type 2 response as a result o f
im m unisation w ith each o f the antigens. C ytokine and antibody p rofiles indicated
a p redom inant type 2 im m une response in m ice im m unised w ith each o f E S , p eak
(1) and p eak (2). T he m ost significant response w as observed in m ice im m unised
w ith ES. E S, peak 1 and peak 2 specific responses w ere also observed in Fasciola
infected m ice.
120
ES injected into the peritoneal cavity o f B A L B /c m ice w as also observed to
stim ulate the pro d u ctio n o f eosinophilia, a cellular response characteristic o f
helm inth infections (B ehm & O vington, 2000).
H ow ever, an eosinophilic
response w as not observed in the com partm ent o f the liver in B A L B /c m ice
infected w ith m etacercariae o f F. hepatica.
T his difference in eosinophilic
responses suggests that m ature flukes in the liver m ay possess an im m uno-evasive
strategy that inhibits the recruitm ent o f eosinophils w hich m ight otherw ise be
harm ful to the parasite.
Injected ES products w ere also observed to have a
stim ulatory effect on neutrophils, w ith increased num bers o f neutrophils recorded
in injected m ice.
Jefferies et al, (1997), observed stim ulation o f neutrophil
populations in sheep injected w ith ES.
A s bo th infection w ith F. hepatica and im m unisation w ith F. hepatica
derived antigens result in the polarisation o f the im m une responses tow ards the
type 2 subtype, it has b een suggested that p arasite products act to divert a possible
protective type 1 response tow ards a type 2 phenotype in order to p rolong survival
w ithin the host.
In the current study w e also investigated im m une responses to m ice infected
w ith F. hepatica.
O ur findings are consistent w ith previous studies in cattle
(B row n et al., 1994; C lery et al., 1996; M ulcahy et al , 1999) and m ice (O ’N eill et
al, 2001), in dem onstrating a polarised type 2 im m une response in anim als
infected w ith F. hepatica.
O ur results show a type 2 im m une response in both
cytokine and antibody profiles o f infected m ice. Studies in rats by T lib a et al,
(2002), observed po larisatio n o f the im m une response 14 days p o st infection, w ith
IL -4 m R N A recorded in the hepatic lym ph nodes. In the current study, IL -4 and
IFN-y m R N A levels in m ice infected w ith m etacercaria o f F. hepatica suggest that
121
the im m une response becom es polarised 1 day post infection, and as such
fascioliasis m ay be considered an excellent m odel for use in the study o f type 2
im m une responses.
In contrast, im m une responses associated w ith other h elm inths such as
Schistosoma mansoni show m ixed and elevated type 1 and type 2 associated
im m une responses at the early stages o f infection, before the induction o f a
polarised type 2 im m une response (B aulada-B enedetti et al ., 1991). T hese results
suggest th at po ten tial vaccines against schistosom iasis should b e linked to
induction o f bo th type 1 and type 2 associated im m une responses. C onversely, as
type 2 responses in fascioliasis appear to be linked w ith pathology, our current
studies investigated the induction o f a polarised type 1 response, w ith the aim o f
providing pro tectio n against infection w ith F. hepatica.
The relationship betw een pathology and im m une expulsion in parasitic
infections rem ains controversial. A fundam ental obstacle to vaccine developm ent
in parasitic infections is the lack o f understanding as to w hat type o f im m une
response should be evoked. It is unclear in m any parasitic infections w hich type
o f im m une response is required by the host in o rder to achieve p rotection against
an invading parasite.
A lso, an effective response elicited b y a p articular parasite
m ay not p rovide sim ilar p rotection against another parasitic infection. For
exam ple, type 2 responses are generally associated w ith expulsion o f Trichinella
spiralis (L aw rence et al., 2000), and in infections involving a num ber o f
gastrointestinal
nem atodes,
T h2
responses
are
generally
associated
w ith
protection, w hile T h l responses are associated w ith susceptibility (G arside et al.,
2000).
S im ilarly im m une expulsion o f gastrointestinal helm inths is generally
associated w ith type 2 responses (L aw rence et al., 1998).
G irod et al.,(2003),
122
suggested that a localised type 2 response m ight be im portant in a protective
response against Neactor americanus. In contrast, intestinal path o lo g y observed in
m any other disease m odels is sim ilar to that observed in helm nith infections, but
has been associated w ith type 1 cytokines.
F or exam ple, studies by M ulcahy et
al ., (1998), suggest a p rotective role for type 1 responses against infection w ith F.
hepatica.
A lso, type 2 responses are not considered effective in expulsion o f
Brugia malayi (L aw rence et al, 1995).
C urrent m ethods o f controlling helm inth diseases em ploy the use o f an ti­
helm inthic drugs.
H ow ever, issues in relation to the evolution o f drug resistant
parasites, and the p resence o f p esticides in food products has m o tivated research
into investigating the po ssib ility o f em ploying m olecular vaccines against these
parasites (D alton et al ., 2003). The ability to purify m R N A from different parasite
life cycle stages and the developm ent o f cD N A expression libraries from m R N A
has pro v en essential to the identification o f im m unogenic p arasite proteins, w hich
m ay be used as vaccine candidates (K nox et al., 2001).
Several anti-parasite
vaccines have been p rev io u sly developed, e.g., the recom binant EG 95 oncosphere
proteins against Echinococcus granulosis and the B m 86 vaccine against Boophilus
microplus. T he cysteine proteases, cathepsin L I and cathepsin L2, w hich have
im portant roles in host-parasite interactions, have b een tw o o f the m ost pro m isin g
F. hepatica vaccine candidates to date. D alton et al., (1996), observed levels o f
protection up to 72.4% protection against infection w ith F. hepatica w hen these
cathepsins w ere used in conjunction w ith liver fluke haem oglobin, the resulting
im m une response bein g predisposed
tow ards
a type
1 im m une
response.
A ntibodies associated w ith type 1 im m une responses have also b e e n associated
w ith a degree o f pro tectio n against infection w ith F. hepatica (M ulcahy et al.,
123
1998).
S im ilarly, B ossaert et al., (2000) suggested that Ig G l pro d u ctio n has no
significant p ro tectiv e effect against infection w ith F. hepatica.
In th e current
study w e investigated the ability o f recom binant cathepsin L, com bined w ith
various adjuvants to establish a type 1 im m une response in B A L B /c m ice. A
polarised type 1 response w ith specificity for re c F h e C L l, w as observed in five
experim ental groups. The m ost significant type 1 response w as observed in m ice
im m unised w ith C L 1, A lum , cpg, and heptavac. T his study also suggested that the
recom binant cathepsin L, and not the inactive m utant cathepsin L is involved in
im m unostim ulation.
124
F u tu r e re c o m m e n d a tio n s
4.2.1: F urther investigations related to our current studies should be perform ed in
order to p rovide a b e tte r understanding o f the im m une responses in individuals
infected w ith F. hepatica. (i)W hile type 2 im m une responses w ere observed in
response to E S, peak 1 and peak 2, further p urification on these products should be
perform ed to investigate their im m unostim ulatory properties. SD S P A G E analysis
o f peak 2 dem onstrated several unidentified bands w hich should be isolated and
investigated w ith reference to their im m unostim ulatory properties,
(ii) O ur
experim ents involving the use o f cathepsin L w ith various adjuvants established a
predom inant type 1 response. F uture investigation should determ ine w h ether this
response provides p rotection against F asciola infection, (iii) Im m unisation w ith
F asciola antigens attached to agarose beads in order to facilitate the prolonged
release o f antigen over tim e, and thus sim ulate the release o f ES products, should
provide a useful insight into the effects o f F. hepatica excretory/secretory products
released during infection.
125
5.1
Bibliography
126
A bane JL, O leage A , R am ajo V , C asanueva P, P erez-A relllan JL, H illy er G V ,
M uro A.
V accination o f m ice against S chistosom a bo vis w ith a recom binant fatty acid
binding protein from F asciola hepatica.
V eterinary P arasitology 2000; 33-42.
A derhem A , U nderhill D M .
M echanism s o f phagocytosis in m acrophages.
A nnu. Rev. Im m unol. 1999;17:593-623. R eview .
A llen JE ,M aizels RM .
Im m unology o f hum an h elm inth infection.
Int A rch A llergy Im m unol. 1996 Ja n ;1 0 9 (l):3 -1 0 . R eview .
A llen JE, M aizels, RM .
T h l-T h 2 : reliable dogm a or dangerous dogm a?
Im m unology T oday 1997; 18:387-392.
A llen JE, M acD onald AS.
Profound supression o f cellular proliferation m ediated b y secretions o f nem atodes.
1998; P arasite Im m unology 20: 241-247.
al-R am adi B K , M ustafa N , A biuH aidir M , F em andez-C abezudo M J.
Induction o f innate im m unity by IL -2-expressing S alm onella confers p rotection
against lethal infection.
M ol Im m unol. 2003; Feb;39(13):763-70.
A m iri P, L ocksley R M , Parslow TG , Sadick M , R ector E, R itter D , M cK errow JH.
T um our necrosis factor alpha restores granulom as and induces p arasite egg-laying
in schistosom e-infected SC ID m ice.
N ature. 1992 A p r 16;356(6370):604-7.
A nderson PH , B erret S, B ru sh PJ, H ebert CN , P arfitt JW , P atterson DS.
B iochem ical indicators o f liver injury in calves w ith experim ental fascioliasis.
V e tR e c . 1977; Jan 15; 100(3):43-5.
A ndrew s SJ.
F asciolosis 1999, Ed. D alton JP, C A B International P ublishing, pp. 7.
A ijo n a R, R iancho J, A guado J, Salesa R, G onzalez-M acias J.
F ascioliasis in developed countries: a review o f classic and aberrant form s o f the
disease.
M edicine (B altim ore). 1995; Ja n ;7 4 (l):1 3 -2 3 . R eview
A rlaud G J, V olkanis JE, T hielens N M , N aray an a SV, R ossi V, X u Y.
T he atypical serene proteases o f the com plem ent system .
A dv. Im m unology. 1998;69:249-307.
B aeza E, P oitou I, V illejoubert C, B oulard C.
C om plem en t d epletion in rats infected w ith F asciola hepatica: in vivo and in vitro
studies.
V et P arasitol. 1994; Feb;51(3-4):219-30.
B aeza E, P oitou I, B oulard C.
Influence o f pro -in flam m ato ry treatm ents on experim ental infection o f rats w ith
F asciola hepatica: changes in serum levels o f inflam m atory m arkers d uring the
early stages o f fascioliasis.
R es V et Sei. 1994; Sep;57(2): 180-7.
B anchereau J, B riere F, C aux C, D auvoust J, L abecque S, Liu Y J., P ulen d ran B,
P alucka K.
Im m unobiology o f dendritic cells.
A nnu R ev Im m unol. 2000;18:767-811. R eview .
B ancroft A J, M cK enzie A N J, G rencis RK.
A critical role for IL-13 in resistance to intestinal nem atode infection.
J Im m unol. 1998; A pr 1;160(7):3453-61.
B argues M D , M angold A J, M unoz-A ntoli C, P ointier JP, M as-C om a S.
SSU rD N A characterization o f lym naeid snails transm itting hum an fascioliasis in
S outh and C entral A m erica
J. P arasitol. 1997 D ec;83(6): 1086-92.
B arrett A, K irschke.
C athepsin B, cathepsin H and cathepsin L.
M ethods in E nzym ology. 80;535-561
B arton G M , M edzhitov R.
C ontrol o f adaptive im m une responses by T oll-like receptors.
C urr O pin Im m unol. 2002; Jun;14(3):380-3. R eview .
B ehm CA , O vington K S.
T he role o f eosinophils in parasitic helm inth infections: insights from genetically
m odified m ice.
P arasitology today 2000; 16:202-209.
B entancor A , P iacen za L, C arm ona C.
Im m unisation w ith cathepsin L proteiniases CL1 and C L 2 secreted by F ascio la
hepatica elicit a p referential type 1 response based on IgG 2a antibodies in rats.
J. H elm inthology, 2002; Sep;76(3): 199-205.
B erasain P, G oni F, M cG onigle S, D ow d A, D alton JP, F rangione B, C arm ona C.
P roteinases secreted b y F ascio la h epatica degrade extracellular m atrix and
basem ent m em brane com ponents.
J P arasitol. 1997; F e b ;8 3 (l):l-5 .
B erquist R, A l-S herbiny M , B arakat R, O lds R.
B lueprint for schistosom iasis vaccine developm ent.
2002; A cta T ro p ica 82, 183-192.
B erry C l, D argie JD.
T he role o f n u trition in the pathogenesis o f ovine fascioliasis.
V eterinary P arasitology, 1976; 2, 317-332.
B jorkm an N , T horsell W .
O n the fine m orp h o lo g y o f the egg shell globules in the vitaline glands o f the liver
fluke (F ascio la hepatica)
Exp. C ell R es, 1963; 32: 153-156.
B oray JC.
Studies on the relative susceptibility o f som e lym naeids to infection w ith F asciola
hepatica and F ascio la g igantica and on the adaptation o f F ascio la spp.
A nn T rop M ed Parasitol. 1 9 6 6 ;M a r;6 0 (l):l 14-24.
B oray JC.
E xperim ental fasciolosis in A ustralia
A dvanced P arasitology. 1969;7, 95-210
B ossaert K ,Jacq u in et E ,S aunders J,F am ir F ,L osson B.
C ell-m ediated im m une response in calves to single-dose, trickle, and challenge
infections w ith F ascio la hepatica.
V et.P arasito l.2000 Feb 2 9 ;8 8 (l-2 ):1 7 -3 4 .
B oyce W M , C ourtney C H , L oggins PE.
R esistance to experim ental infection w ith F asciola h ep atica in exotic and dom estic
breeds o f sheep.
Int J P arasitol. 1987; O ct; 17(7): 1233-7.
B radford, M ..M .
A rapid and sensitive m eth o d for quantification o f m icrogram quantities o f p rotein
utilizing the principle o f p rotein dye binding.
A nalytical B iochem istry.72;248-254.
B rady M , O ’N eill SM , D alton JP, M ills K H G .
F asciola h epatica supresses a protective T h l response against B ordatella
pertusssis. Infect. Im m u n .l9 9 9 ;6 7 , 5372-5378.
B rophy PM , C row ley P, B arrett J.
D etoxification reactions o f F asciola h epatica cytosolic glutathione transferases.
M ol B iochem Parasitol. 1990 M ar;39(2): 155-61.
B row n W C ,D avis W C ,D obbelaere D A ,R ice-F icht AC.
C D 4+ T -cell clones obtained from cattle chronically infected w ith F asciola
hepatica and specific for adult w orm antigen express both unrestricted and Th2
cytokine profiles.
Infect Im m un. 1994 M a r;6 2 (3 ):8 18-27.
B row n W C , M cE lw ain T F, P alm er G H , C hantler SE, E stes DM .
B ovine C D 4(+ ) T -lym phocyte clones specific for rhoptry-associated p ro tein 1 o f
B abesia b ig em in a stim ulate enhanced im m unoglobulin G1 (Ig G l) and IgG 2
synthesis.
Infect Im m un. 1999 Ja n ;6 7 (l): 155-64.
B runet LR , K o p f M A , Pearse EJ.
S chistosom a m ansoni: IL -4 is necessary for concom itant im m unity in m ice.
J. Parasitology. 1999;85:734-746.
B urden D J, B land A P, H am m et N C , H ughes DL.
F ascio la hepatica: m igration o f new ly excysted ju v en ile s in resistant rats.
E xp Parasitol. 1983 O ct;56(2):277-88.
B utterw orth ES.
C ell-m ediated dam age to helm inths.
A dv. Parasitol. 1984;23:143-235.R eview .
C apron A , D essaint JP.
E ffector and regulatory m echanism s in im m unity to schistosom es: a heuristic
view .
A nnu R ev Im m unol. 1985; 3:455-76. R eview
C apron M , C apron A.
Im m unoglobulin E and effector cells in schistosom iasis.
Science. 1994; 264, 1876-1877.
C arm ona C, D ow d A J, S m ith A M , D allton JP.
C athepsin L proteinase secreted b y F asciola h ep atica in vitro prevents antibodym ediated eosinophil attachm ent to new ly excysted ju v eniles.
M ol B iochem Parasitol. 1993 N ov; 62(1):9-17.
C aulada-B enedetti Z, V ecchio LC , Pardi CC, M assironi SM , D 'Im perio L im a M R ,
A braham sohn I A.
A ctivation o f C D 4+ and C D 8+ parasite-specific T -cells by m acrophages infected
w ith live T. cruzi am astigotes.
Im m unol Lett. 1998 S ep;63(2):97-105.
Cervi L, R ossi, G, M asih DT.
P otential role for excretory-secretory form s o f glutathione-S -transferase (G S T ) in
F ascio la hepatica.
Parasitology, 1999 D ec;119 (Pt 6):627-33.
C hapm an CB , M itchell GF.
P roteolytic cleavage o f im m u noglobulin by enzym es released by F ascio la
hepatica.
V et P arasitol. 1982 N o v ;l 1(2-3): 165-78.
C harbon JL, Spahni M , W icki P, P fister K.
C ellular reactions in the sm all intestine o f rats after infection w ith F asciola
hepatica.
P arasitol Res. 1991 ;77(5):425-9.
C hauvin A , B o uvet G, B oulard C.
H um oral and cellular im m une responses to F asciola hepatica experim ental
p rim ary and secondary infection in sheep.
Int J Parasitol. 1995 O c t;2 5 (l0): 1227-41.
C hauvin A , B oulard C.
L ocal im m une response to experim ental F ascio la h ep atica infection in sheep.
Parasite. 1996 S ep;3(3):209-15.
C heever A W , H offm ann K F, W ynn T A
Im m unopathology o f schistosom iasis m ansoni in m ice and m en.
Im m unlogy Today. 2000 Sep;21(9):465-6.
C hom czyniski, P, Sacchi N.
S ingle-step m eth o d o f R N A isolation b y acid guanidinium thiocyanate-phenolchloroform extraction.
A nal B iochem . 1987 A p r;1 6 2 (l):1 5 6 -9 .
C iffone M G .
ln terleu k in -2 activated rat natural k iller cells express inducable nitric oxide that
contribtes to cytotoxic functions and interferon-y production.
B lood. 1999; 9 3 ,3 8 7 6 -3 8 8 4 .
C jaja M J, W einer FR , F landers K C . G ian-w ind M A , B iem pica L, Z e m M A .
In vitro association o f transform ing grow th fa c to r-1 w ith fibrosis.
B iol. 1989;108:2477.
C lark EA , L edbeter JA.
H ow B and T cells talk to each other.
N ature. 1994 Feb 3;367(6462):425-8. R eview .
C lery D, T o rgerson P, M ulcahy G.
Im m une responses o f chronically infected adult cattle to F ascio la hepatica.
V et Parasitol. 1996 M a r;6 2 (l-2 ):7 1 -8 2 .
C ollins P ,S tack C, M aule A, D onnelly S. O ’N eill S, D alton JP.
C athepsin L I : T he m ajor protease involved in liver fluke (F asciola hepatica)
virulence: prop ep tid e cleavage sites and autoactivation o f the zym ogen secreted
gastroderm al cells.
Journal o f B iological C hem istry S u b m itte d .
Cooper ES,Spencer J, Whyte-Alleng CA,Cromwell 0,Whitney
P,Venugopal S,Bundy DA,Haynes BMacDonald TT.
Intestinal nem atode infections in children: the pathophysiological price paid.
P arasitology. 1992; 104 Suppl: S91-103. R eview .
C onstant SL, B o tto m ly R.
Induction o f T h l and T h2 C D 4+ T cell responses: the alternative approaches.
A nnu R ev Im m unol. 1997;15:297-322. R eview
C ulley F J,B ro w n A ,C onroy D M ,S abroe I,P rithchard D I,W illiam s TJ.
E otaxin is specifically cleaved by hookw orm m etalloproteases prev en tin g its
action in vitro and in vivo.
J.Im m unology. 2000 D ec. 1; 16 5 (1 1):6447-53.
D alton JP, H effem an M .
T hiol p roteinase released inviteo by F asciola hepatica
M o lecular B iochem ical P arasitology. 1989; 35: 161-166.
D alton JP, M cG onigle S, R olph TP, A ndrew s SJ.
Induction o f p rotective im m unity in cattle against infection w ith F asciola h epatica
b y vaccination w ith cathepsin L proteinases and w ith hem oglobin.
Infect Im m un. 1996 D ec;64(12):5066-74.
D alton JP ,B rindley PJ, K nox D P ,B rady C P ,H otez P J,D onnelly S,O 'N eill
S M ,M ulcahy G ,L oukas A.
H elm inth vaccines: from m ining genom ic inform ation for vaccine targets to
system s used for pro tein expression.
Int J P arasito lo g y .20003 M ay;33(5-6):621-40.
D argie JD , B erry C L, P arkins JJ.
T he path o p h y sio lo g y o f bovine fascioliasis:studies on feed intake and
digestability, body w eig h t and nitro g en b alance o f sheep given ratio n s o f hay, or
hay and pelleted supplem ent.
R es .Vet. Science. 1979; M ay; 26 (3):289-95.
D aw es B.
S om e o bservations o f F ascio la h ep atica L during feeding operations in the hepatic
paren ch y m a o f the m ouse, w ith notes on the nature o f liver dam age in this host.
Parasitology. 1963;53, 135-143.
D aw es B.
H y p erp lasia o f the b ile duct in fascioliasis and its relation to the p roblem o f
nutrition in the liver fluke, F asciola h epatica L.
P arasitology. 1963a;53, 123-133.
D aw es B
F ascio la hep atica L., a tissue feeder.
N ature. 1963 Jun 8; 198:1011-2..
D aw es B, H ughes DL.
Fascioliasis: the invasive stages o f F asciola h epatica in m am m alian hosts.
A dvances in P arasitology. 1964; 2, 97-168.
D em psey PW , A llison M E , A kkaraju S, G oodnow CC, F earon DT.
C 3d o f com plem ent as a m olecular adjuvant: bridging innate and acquired
im m unity.
Science. 1996 Jan 19;271(5247):348-50.
D e V ries JE, Z uraw ski G.
Im unoregulatory properties o f IL-13: its poteneial role in atopic disease.
Int. A rch A llergy Im m unology. 1995; 106:175-9.
D iefenbach A , S chindler H , R o llin g h o ff M , Y okoyam a W M , B ogdan C.
R equirem ent for type 2 N O synthase for IL-12 signaling in innate im m unity.
Science. 1999 M ay 7;284(5416):951-5.
D ixon KE.
The p h y siology o f excystm ent o f the m etacercaria o f F asciola hepatica.
Parasitology. 1966;A ug;56(3):431-56.
D ow C, R oss JG , T odd K JR.
The p athology o f experim ental fascioliasis in calves.
J C om p Pathol. 1967 O ct;77(4):377-85.
D ow d A J, S m ith A M , M cG onigle S, D alton JP.
P u rification and characterisation o f a second cathepsin L proteinase secreted by
the parasitic trem atode F ascio la hepatica.
E ur J B iochem . 1994 Jul l;2 2 3 (l):9 1 -8 .
D uffusW P H , Franks D.
In vitro effect o f im m une serum and bovine granulocytes on ju v e n ile F ascio la
hepatica.
C lin E xp Im m unol. 1980 S ep;41(3):430-40.
D urbin CG.
L ongevity o f the liver fluke F ascola sp in sheep.
In: O tto. G.F. (ed.) P roceedings o f the H elm inthological S ociety o f W ashington.
The H elm inthological S ociety o f W ashington, 1952; 120 pp.
E steban JG , F lores A, A guirre C, Strauss W , A ngles R, M as-C o m a S.
Presence o f very high prevalence and intensity o f infection w ith F asciola hepatica
am ong A y m ara children from the N orthern B olivian A ltiplano.
A c ta T ro p . 1997 Jun 24;66(1): 1-14.
E stes D M , C lo sser N .M , A llen GK.
IF N -gam m a stim ulates IgG 2 p roduction from bovine B cells costim ulated w ith
anti-m u and m itogen.
Cell Im m unol. 1994 A pr l;1 5 4 (l):2 8 7 -9 5 .
F inkelm an FD , K otana IM , U rban JF, H im es J, O hara N , T ung A S, S am ple JG ,
Paul W E.
IL -4 is required to g enerate and sustain in vivo IgE responses.
J Im m unol. 1988 O ct 1;141(7):2335-41.
F ukum oto S,H irai K ,T anihata T ,O hm ori Y ,S tuehr D J,H am ilton TA.
E xcreto ry /secreto ry products from plerocercoids o f S pirom etra erinacei iN O S and
chem okine m R N A levels in peritoneal m acrophages stim ulated w ith cytokines
ond/or LPS.
P arasite Im m unol. 1997 Jul;19(7):325-32.
G alli SJ, L antz CS.
A llergy in F undam ental Im m unology, edn 4, E dited by Paul, W .E. Philadelphia:
L ippncott-R aven Press. 1999; 1137-1184.
G am eel AA.
T issue ascorbic acid concentrations in rats experim entally infected w ith F asciola
hepatica.
Z Parasitenkd. 1982;68(2): 181 -4.
G arside P ,K ennedy M W ,W akelin D ,L aw rence CE.
Im m nopathology o f intestinal helm inth infection.
P arasite Im m unol. 2000 D ec;22(12):605-12. R eview .
G irod N , B row n A, P ritchard D I, B illet EE.
Successful v accination o f B A L B /cm ice against hookw orm (N ectar am ericanus):
the im m unological phenotype o f the protective response.
Int J P arasitology, 2003 Jan ;3 3 (l):7 1 -8 0 .
G lauert A M , L am m as D A , D uffus W PH .
U ltrastructural observations on the interaction in vitro betw een bovine eosinophils
and ju v en ile F ascio la hepatica.
P arasitology. 1985 D ec;91 ( P t 3):459-70.
G old D, G oldberg M.
E ffects o f light and tem perature on hatching in F asciola hepatica
(T rem atoda:F asciolidae)
Israel Journal o f Z o ology 1976; 25, 178-185.
G oose J.
P ossible role o f excretory/secretory products in evasion o f host defences b y
F asciola hepatica.
N ature. 1978 Sep 21 ;2 7 5 (5 6 7 7 ):2 16-7.
G upta R K ,S iber GR.
A djuvants for hum an vaccines-current status, problem s and future prospects.
V accine. 1995 ;O ct; 13(14): 1263-76.
G utierrez A, P erera G, Y om g M , Sanchez J ,L in W .
L ife-history traits o f F o ssaria cubensis (G astropoda: L ym naeidae) under
experim ental exposure to F ascio la h epatica (T rem atoda: D igenea).
M em Inst O sw aldo Cruz. 2000 S ep-O ct;95(5):747-52.
H anisch M.
H orm one-in duced uptake o f calcium and glycogenolysis by perfused liver o f rats
infected w ith F ascio la hepatica.
FE B S L ett 1991, Jul 8; 285 (1) 94-96.
H annah REB .
F asciola hepatica: G lucocalyx replacem ent in the ju v en ile as a possible
m echanism for pro tectio n againsy host im m unity
E xperim ental Parasitology. 1980;50, 103-114.
H einzei FP, R erko R M , H ujer A M , M aier R A Jr.
Increased capacity for interleukin-2 synthesis p arallels disease p rogression in m ice
infected w ith L eishm ania m ajor.
Infect Im m un. 1998 S ep;66(9):4537-40.
H ope C aw dery M J, G ettinby G, G rainger JN R.
M athem atical m odels for predicting the prevalence o f liver-fluke disease and its
control from biological and m eteorological data .
In. W eather and P arasitic A nim al D isease, W orld M eteorological
O rganisation, 1978; T echnical note No. 159, pp21-38.
H opkins D R.
H om ing in on helm inths
A m erican jo u rn a l o f tropical m edecine and hygene. 1992; 46 626-634.
H ughes DL.
F ascioloa and fascioloides. In Im m une R esponses in Parasitic Infections:
Im m unology, Im m unopathology, and Im m onoprophylaxis. V olum e II:
T rem atodes and C estodes, 1987;E.J.L. Soulsby, ed., p. 91, C R C P ress, Florida,
U SA .
Janew ay C A Jr.
A pproaching the asym ptote? E volution and rev olution in im m unology.
C old Spring H arb Sym p Q uant Biol. 1989;54 P t 1:1-13. R eview
Jefferies JR, C orbett E, B arret J, T urner RJ.
P olarisation and chem okinesis o f ovine and hum an neutrophils in response to
F asciola h ep atica excretory-secretory products.
International jo u rn a l for parasitology. 1996; V ol. 26, N o. 4 pp 409-414.
Jefferies JR, T uner JR , B arret J.
E ffect o f F ascio la h ep atica excreory-secretory products on the m etabolic b u rst o f
sheep and h u m an neutrophils.
Int. J. P arasitol. 1997 Sep; 27 (9): 1025-9.
K eegan PD , T rudgett A.
F ascio la h ep atica in the rat: im m une responses associated w ith the d evelopm ent o f
resistance to infection.
P arasite Im m unol. 1992 N ov;14(6):657-69.
K elly M E , C a h n A C .
R egulation o f B cell function by linker proteins.
C urr O pin Im m unol. 2000 Jun;12(3):267-75.
K inet JP.
The h ig h-affinity IgE receptor (F c c R l): from p h y siology to pathology.
A nnu. R ev. Im m unology. 1999;17:931-972.
K nox D P ,R edm ond D L ,S kuce P J,N ew lands GF.
T he contribution o f m olecular b iology to the developm ent o f vaccines against
nem atode and trem atode parasites o f dom estic rum inants.
V et Parasitol.2001 N ov 22; 101 (3 -4 ):3 11-35. R eview .
K uhn R, R ajew sk y K, M u ller W .
G eneration and analysis o f interleukin-4 deficient m ice.
Science. 1991 N ov 1 ;2 5 4 (5 0 3 2 ):7 0 7 -10.
L aem m li U .K .
C leavage o f structural proteins during the assem bly o f the head o f b acteriophage
T4.
N ature (L onon).1970; 227:680-685.
L aw rence R A , A llen JE, G regory W F, K o p f M , M aizels RM .
Infection o f IL -4-deficient m ice w ith the parasitic nem atode B ru g ia m alayi
dem onstrates that h ost resistance is not dependent on a T helper 2 -d o m in ated
im m une response.
J Im m unol. 1995 Jun 1; 154(11 ):5 9 9 5 -6 0 0 1 .
L aw rence C E ,P aterson JC ,W ei X Q ,L iew F y,G arside P ,kennedy M W .
N itric oxide m ediates intestinal p athology but not im m une expulsion during
T richinella spiralis infection in m ice.
J Im m u n o l.2000 A p r 15;164(8):4229-34.
Le B on A , T ough DF.
L inks b etw een innate and adaptive im m unity via type I interferon.
C urr O pin Im m unol. 2002 A ug;14(4):432-6. R eview
L enton LN , B ygrave FL, B ehm CA , B orray JC.
F ascila h ep atica infection in sheep: changes in liver m etabolism .
Res. V et Sci. 1996 S ep;61(2):152-156.
L evy F, K ristofic C, B rinkm an V.
R ole o f IL-13 in C D 4 T cell dependant IgE p roduction in atopy. Int. A rc. A llergy
Im m unology. 1997; 112:49-58.
L im a C, P erini A , G arcia M L, M artins M .A , T eixeira M M , M acedo M.
E osinophilic inflam m ation! and airw ay h y per-responsiveness are p ro fo u n d ly
inhiited by helm in th (A scaris suum ) extract in a m urine m odel o f asthm a.
Clin. Xp. A llergy. 2002 N ov; 32(11): 1659-66.
L loyd A R , O ppenheim JJ.
P o ly ’s lam ent: the n eglected role o f p olym orphonuclear neutrophil in the afferent
lim b o f the im m une response.
Im m unology today. 1992; 197-172.
M acD onald A S, A raujo M I, Pearse EJ.
Im m unology o f P arasitic H elm inthic Infections.
Infection and Im m unity. 2002;427-433.
M aizels R M , B undy D A , Selkirk M E, Sm ith D F, A nderson R.M .
Im m unological m odulation and evasion by helm inth parasites in hum an
populations.
N ature. 1993 O ct 28;365(6449):797-805. R eview
M antovani A , B ottazzi B, C olotta F, Sozzani S, R uco L.
T he origin and function o f tum or-associated m acrophages.
Im m unology T oday. 1992 Jul;13(7):265-70. R eview
M artinez-M oreno A , M artinez C ruz M S, M artinez FJ, G utierrez PN , H ernandez S.
D etection o f antibodies o f F ascio la hepatica excretory-secretory antigens in
experim entally infected goats by enzym e im m unoabsorbant assay.
V et. P arasitol. 1996;62, 247-252.
M artinez-M oreno A, Jim inez-L uque V, M oreno T, R odendo E S H , M artin de las
M elus J, P erez J.
L iver p athology and im m une response in experim ental F asciola hepatica
infections o f goats
V eterinary Parasitology. 1999 D ec;82 19-33
M as-C om a M S, E steban JG , B argues M D.
E pidem iology o f hum an fascioliasis: a review and proposed new classification.
B ull W orld H ealth O rgan. 1999;77(4):340-6. R eview .
M astellos D , L am bris JD.
C om plem ent: m ore than a “guard” against invading pathogens?
T rends in Im m unology. 2002 0 c t;2 3 (1 0 ):4 8 5 -9 1 . R eview .
M attes O.
Z ur frage der W irtsauffindung der Parasiten a u f G rund experim enteller
U n tersuchungen an L ebergelm iracidien. V erhandlungen der D eutschen
Z o o logischen G esellschaft. 1936;38, 183-186.
M cgonigle S, D alton JP.
Isolation o f F ascio la h epatica haem oglobin.
P arasitology. 1995 A u g ;l 1 l(P t 2):209-15.
M cG onigle S, C urley G P, D alton JP.
C loning o f peroxiredoxin, a novel antioxidant enzym e, from the h elm inth parasite
F ascio la hepatica.
P arasitology. 1997 Jul;115 ( Pt 1): 101-4.
M edzhitov R, Janew ay C.
Innate im m unity: the virtues o f a nonclonal system o f recognition.
Cell. 1997 O ct 31;91(3):295-8. R eview
M edzhitov R, Janew ay C.
Innate im m une recognition: m echanism s and pathw ays.
Im m unol Rev. 2000 Feb; 173:89-97. R eview
M eeusen E, L ee C S, B randon M R.
A ntibody secreting cells as specific probes for antigen identification.
J Im m unol M ethods. 1995 Jun 3 ;1 7 2 (l):7 1 -6 .
M eeusen E. B alic A.
D o eosinophils have a role in the killin g o f helm inth parasites?
P arasitol Today. 2000 M ar;16(3):95-101. R eview
M ilb o u m e EA , H ow ell M J.
E o sinophilia in nude rats and nude m ice after infection w ith F asciola hepatica, or
injection w ith its ES antigens.
Intem atonal jo u rn a l for parasitology. 1997 Vol. 27 N O .9 99. 1099-1105.
M ittrucker H W , K auffm ann SH
Im m une response to infection w ith S alm onella typhim urium in m ice.
J L eukoc Biol. 2000 A pr; 67(4): 457-63. R eview .
M odavi S, Isse ro ff H.
F asciola hepatica: collagen deposition and other h istopathology in the rat hosts
bile duct caused by the p arasite and by proline infusion.
Exp. Parasitology. 1984 D ec; 58 (3):239-44.
M ossm an T R , C offm an, RL.
T h l and T h2 cells: different patterns o f lym phokine secretion lead to different
functional p roperties.
A nnual R eview Im m unology. 1989;7:145-174.
M ulcahy G, O ’C onnor F, M cG onigle S. D ow d A, C lery D G , A ndrew s SJ, D alton
JP. C orrelation o f specific antibody titre and avidity w ith p rotection in cattle
im m unized against F ascio la hepatica.
V accine. 1998 M ay-Jun; 16(9-10):932-9.
M ulcahy G ,O 'C onnor F ,C lery D, H ogan SF ,D ow d A J,A ndrew s S J,D alton JP.
Im m une responses o f cattle to experim ental anti-F aasciola hep atica vaccines.
Res. V et Sci. 1999 A u g ;6 7 (l):2 7 -3 3 .
N ear K A , Stow ers A W , Jankovic D, K aslow D C.
Im proved im m unogenicity and efficacy o f the recom binant 19-kilodalton
m erozoite surface p rotein 1 b y the addition o f oligonucleotide and alum inium
hydroxide gel in a m urine m alaria vaccine m odel.
Infection and Im m unity. 2002 Feb; p269-701.
N ehanus W.
U ber den chem ischen Sinn der M iracidien von F asciola hepatica Z eitsch rift fur
Parasitenkunde. 1953; 1 5 ,4 7 6 -4 9 0 .
O 'N eill SM , P arkinson M , Strauss W , A ngles R, D alton JP.
Im m unodiagnosis o f F asciola h epatica infection (fascioliasis) in a hum an
p opulation in the B olivian A ltiplano using purified cathepsin L cysteine
proteinase.
A m J T rop M ed H yg. 1998 A pr;58(4):417-23.
O 'N eill SM , B rady M T ,callanan JJ,M ulcahy G, Joyce P ,M ills K H ,dalton JP.
F asciola h ep atica infection dow n reg u latesT h l response in m ice.
P arasite Im m unol.2000 M ar;22(3): 147-55.
O 'N eill SM , M ills K H , D alton JP.
F asciola h ep atica cathepsin L cysteine protease supresses B ordetella pertussisspecific in terfero n -g am m a p roduction in vivo.
P arasite Im m unol.2001 O ct;23(10):541-7.
O rtiz PL, C laxton JR , C larkson M J, M cG arry J, W illiam s D JL.
The specifity o f antibody responses in cattle naturally exposed to F asciola
hepatica. V aterinary Parasitology. 2000; 93 121-134.
P antelouris EM .
T he C om m on L iver Fluke. P ergam m on Press, O xford, L ondon, N ew Y ork, P aris
and F rankfurt 1965.
P iedrafita D.
Im m une m echanism s o f k illing ju v en ile F asciola hepatica.
PhD . Thesis, 1995, L a T robe U niversity, M elbourne A ustralia.
P iedrafita D , S pithill TW . D alton JP, B rindley PJ, Sandem an M R , W ood PR ,
P arsons JC.
Juvenile F ascio la h ep atica are resistant to killing in vitro by free radicals
com pared w ith larvae o f Schistosom a m ansoni.
Parasite Im m unol. 2000 Jun;22(6):287-95.
P oitou I, B aeza E, B oulard C.
H um oral and cellu lar im m une responses in rats during a p rim ary infestation w ith
F asciola hepatica.
V eterinary Parasitology. 1992; 45:59-71.
P ulendran B, P alucka K, B anchereau J.
S ensing pathogens and tuning im m une responses.
Science. 2001 Jul 13;293(5528):253-6. R eview .
P urkerson JM ,Isak so n PC.
Interleukin 5 (IL -5) provides a signal that is required in addition to IL -4 foe
isotype sw itching to im m unoglubulin (Ig) G1 and IgE.
J. E xp M ed. 1992 A p r l;1 7 5 (4 ):9 7 3 -8 2 .
R oberts EW .
Studies on the life-cycle o f F asciol hepatica (L innaeus) and o f its snail host,
L im naea (G alba) tru n catu la (M uller), in the field and under controlled conditions
in the laboratory.
A nnals o f T ropical M edicine and P arasitology. 1950;44, 187-206.
R ondelaud D , D rey fuss G, B outeille B, D arde M L.
C hanges in h u m an fasciolosis in a tem perate area: about som e o bservations ov er a
28-year p eriod in central France.
Parasitol Res. 2000 S ep;86(9):753-7.
R oss JG , T odd JR, D ow C.
S ingle experim ental infections o f calves w th liver fluke, F ascio la h ep atica
(L in n e u s (1785)
J. C om p. P athology. 1966; Jan; 76 (1): 67-81.
R ow an W B.
T he m ode o f hatch in g o f the egg o f F asciola hepatica.
E xperim ental Parasitology. 1956; 5, 118-137.
S alehaa AA .
L iver fluke disease (fascioliasis): epidem iology, econom ic im pact and public
health significance.
Southeast A sian J T rop M ed Public H ealth. 1991 D ec;22 Suppl:361-4. R eview .
Sallusto F, M ackay CR, L anzavecchia A.
Selective expression o f the eotaxin receptor C C R3 by hum an t helper 2 cells.
Science. 2001, 277:2005.
S antam aria M .
E ffector lym phocytes in autoim m unity.
C urr O pin Im m unol. 2001 D ec;13(6):663-9. R eview
Schw acha M G , M eissler JF, E instein TK.
S alm onella typhim urium infection in m ice induces nitric oxide-m ediated
im m unosuppression through a natural k iller cell-dependent pathw ay.
Infect Im m un. 1998 D ec;66(12):5862-6.
Severinson E, F ernandez C, Stavnezer J.
Induction o f germ -line im m unoglobulin heavy chain transcripts by m ito g en s and
interleukins p rio r to sw itch recom bination.
E ur J Im m unol. 1990 M ay;20(5): 1079-84.
S her A, C olley DG .
Im m unoparasitology. In F undam ental Im m unology. Paul,W .E . ed. R aven Press,
N ew Y ork 1989.
Sher A, C offm an RI.
R egulation o f im m unity to parasites by T cells and T cell-derived cytokines.
A nnu R ev Im m unol. 1992;10:385-409. R eview
Sinclair KB.
The effect o f co rticosteroid on the pathogenecity and developm ent o f F asciola
h epatica in lam bs.
Br. Vet. J. 1968 A pr; 124(4) 133-9.
S inclair KB.
The resistance o f sheep to F asciola hepatica : studies on the path o p h y sio lo g y o f
challenge infections.
Rs. Vet. Sci, 1975 N ov;19 (3):296-303.
Sm ith A M , D ow d A J, M cG onigle S, K eegan PS, B rennan G, T rudgett A, D alton
P u rification o f a cathepsin L -like proteinase secreted by adult F ascio la hepatica.
M ol B iochem Parasitol. 1993 N o v ;6 2 (l):l-8 .
Sm ith A M ,C legg J.A.
Im proved culture o f F asciola hepatica in vitro.
Z P arasitenkd. 1981 ;66(1 ) :9 - l 5.
S m yth JD , H alton D W .
The P h ysiology o f T rem atodes, 2nd edn. C am bridge U niversity P ress, C am bridge.
1983; 446pp
Sm ythies LE, C oulson PS, W ilson RA.
M onoclonal antibody to IFN-y m odifies pulm onary inflam m atory responses and
abrogates im m unity to S chistosom a m ansoni in m ice vaccinated w ith attenuated
cercaria.
Journal o f Im m u n o lo g y . 1992; 149, 3654-3658.
Spithill TW , P iedrafita D , Sm ooker PM .
Im m unological approaches for the control o f fasciolosis.
Int. J. P araasitol.1997 0 c t;2 7 (1 0 ): 1221-35.R eview
Spithill TW , D alton JP.
P rogress in developm ent o f liver fluke vaccines.
P arasitology T oday. 1998; 14 224-227.
Sukhedo M V K , M e ttric k D F .
T he b ehaviour o f the ju v e n ile F asciola hepatica.
Journal o f Parasitology. 1986; 72, 492-497.
T ang L, O u X, H enkle-D uhrsen K, Selkirk M E.
E xtracellular and cytoplasm ic C uZ n superoxide dism utases from B rugia lym phatic
filarial nem atode parasites.
Infect Im m un. 1994 M ar;62(3):961-7.
T hreadgold LT.
F asciola hepatica: ultrastructure and histochem istry o f the glycocalyx o f the
tegum ent.
Exp Parasitol. 1976 F e b ;3 9 (l):l 19-34.
T liba O, M oire N , Le V e m Y , B oulard C, C hauvin A, Slibille P.
E arly hepatic im m une responses in rats infected w ith F asciola hepatica.
V et Res. 2002 M ay-Jun;33(3):261-70.
U guccioni M , M ackay C R , O chensberger P, L oetscher P, R his S, L aR o sa G J, R ao
P, P onath PD , B ag g io h m M , D ahinden C A
H igh expression o f the chem okine receptor C C R 3 m hum an b lo o d baso p h ils role
in in activation b y eotaxm , M C P -4, and o ther chem okm es
Journal o f C lm In v est 1997,100 1137
W edem eyer J, T sai M , G alli SJ
R oles o f m ast cells and b asophils in innate and acquired im m unity
C urr O pm Im m unol 2000 D ec, 12(6) 624-31 R eview
W ijffels G L , P anaccio M , Salvatore L, W ilson L, W alker ID, S pithill T W
The secreted cathepsm L -like proteinases o f the trem atode, F ascio la hepatica,
contain 3-hydroxyproline residues
B iochem J 1994 M ay 1,299 ( P t 3) 781-90
W ilson R A , P u llm R , D enison J
A n investigation o f the m echanism o f infection b y digenic trem atodes the
penetration o f m in c id iu m o f F asciola h ep atica into its snail h ost L ym naea
tru ncatula
\
P arasito lo g y 1 9 7 1 ,6 3 ,4 9 1 -5 0 6
\
\
W ynn TA , H offm ann K F
D efining a S chistosom iasis V accination Strategy- Is it really T h l versus T h 2 ?
P arasitolgy today 2000, vol 16, no 11
Z im m erm an G L, K e rk v h e t N I, B rauner JA , C erro JE
\
Vlodulation o f h o st im une responses by F ascio la h epatica resp o n ses by peripheral
m p h o cy te s to m itogens during liver fluke infections m sheep Journal o f
rasitology 1983,69 473-477